Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F44F1.5   

sjj_F44F1.5RNAiJA:F44F1.5
PCR_productsjj_F44F1.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF44F1.5 Source_evidenceePCR738WS150 Sequence/Annotation Release
Overlaps_Gene F44F1.5 Source_evidenceePCR738WS150 Sequence/Annotation Release
Chunk_score Abs_score675
Max_abs_score675F44F1.5
Specificity_index0.858
Rel_score1
Map_statusUnique_ePCRI1325942213260504
F44F1.6 Chunk_score Abs_score112
Specificity_index0.142
Rel_score0.166
Overlaps_transcriptF44F1.5 Source_evidenceePCR738WS150 Sequence/Annotation Release
WB_DNA_textsjj_F44F1.51083tgcgttgatgaactttcctgtgctattgtcgtaatgatattttgaatatctcccggttttcttggaaagaacagccacgacaattgttgtgaatccgcaatattgaattctgaacggtgcgagagtcttcaagtagtccaaaaatccaaactcattactgatttctgttacttcttcatcttctctaaccatcaatccattcgtctcaatactttgcattaccagtgtagtaactggattttttggtgaacatgcatgcatagacgatcttgtcatcattgctccagtttcatctctttcaatcacaatagtctctttctcaccatttaatactgtgaccatactccctgtcgtggctttttcccgatcataaaccaactctggacgatcaacttccacaaatctgcgagttttgaaagaatagaaactgttccatcttgttcgacatcgagttgaatgcaaaaatcacacggtttccaatctcttcacaccagacagcgtagtcaggaaagaggcccttctcggcaataattggcaaacatggagagcacacatgaggtacaaaggtatccttttcagcgcagaactcaaatggataagaacgaccatccggatgagctacacgaatggttctcattttcagtgatgagcatttgcaaacggtccacttgagactacgatctttttgttgagatccgggaattcgagtgtacggaagcttgaaagcagaggcagtggaaaagatagacatcggagaagaagatctgctagaggtatccatggtatctgaaattgaacaatttgtcaactgttgtcacaatgtgacaacaataagtaaagaggagatgcaaaattcatgagccaaaaaataactgtgaacaaataggagagcgagctaaacaacaactaacctgctccaagcaaacctgcaaaaaaaatgaatgacaggagagtgtattgcaacgtgtatgacgttagaacgctgtgcaaggccgtgcagaaagtaatcgatagagtgtgagaggtatcgggaagatgtggtgaccctagaggagagtggcatcttactggggcaatgcaagt