Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F44F4.11   

sjj_F44F4.11 RNAi JA:F44F4.11
Simmer:F44F4.11:Repeat_a
Simmer:F44F4.11:Screen
PCR_productsjj_F44F4.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF44F4.11 Source_evidenceePCR930WS150 Sequence/Annotation Release
Overlaps_Gene F44F4.11 (3)
Overlaps_transcriptF44F4.11 Source_evidenceePCR942WS150 Sequence/Annotation Release
WB_DNA_textsjj_F44F4.111170ggcgcaacactatttccctatttcttcatagttcttcttggcctcgccgctgaccactattgtccttctcttctccccgtagtatacataacgcccgtatatctttgcgttcctacgttctacgattttatagttaattttactattctgaacctaaatttctttcaattttcagagaaaaaaaaccatgcgtgaggtaatctccattcacgttggacaggcgggagttcaaattggaaatgcttgctgggaactatactgtctcgagcacggaattcaacccgatggaactatgccttctgagcaacaaaatgagggtggatccttcaccacgttcttctcagatactggaaatggacgctatgttccgagatctatttttgtggatcttgagccaacagtcgtcgacgagatccgcactggaaactacaagaagctgttccatccagaacaaatgatcactgggaaggaagacgctgctaataactatgctcgtggtcactacaccgttggcaaggagctcatcgacactactcttgacagaatccgtcgtctcgccgacaactgtagtggtcttcaaggattctttgtcttccactccttcggtggaggtactggatccggattcacctcactgctgatggaacgtttgtcggttgactacggaaagaagtcgaaactagagttttcaatctatccagctccacaagtttccactgcagtcgttgagccatacaactcgatccttactactcatactactttggagcactccgattgtgcattcatggttgataacgaggcgatctacgacatttgcaagcgaaatttggatgttgaccgaccgagttacaccaatctcaacagaattatctctcaggtttcgcaaaatacttgttttaatgtatcctatgtgtttccttttcttttcaggttgtgtcttcaatcaccgcttcactcagatttgacggagctctcaacgtggatctcaacgagttccagaccaacttggtgccatacccaagaattcatttcccattggcctcttacactccattgatctctgccgagaaggcatatcacgaggctctgtctgtcaatgacatcaccaatagctgcttcgaaccagcaaatcagatggtcaaatgtgatccacgcaacggaaagtac