Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F44F4.2   

sjj_F44F4.2 RNAi JA:F44F4.2
Simmer:F44F4.2
PF:GL1_4B9
PCR_productsjj_F44F4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F44F4.2 Source_evidenceePCR979WS150 Sequence/Annotation Release
Chunk_score Abs_score874
Max_abs_score874F44F4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1088316610884338
Overlaps_transcript F44F4.2.2 Source_evidenceePCR979WS150 Sequence/Annotation Release
F44F4.2.1 Source_evidenceePCR979WS150 Sequence/Annotation Release
WB_DNA_textsjj_F44F4.21173ggaagaccatacgccagaaatcttcttgagtgttcttcaatggagcctgtgcacagatgaatgtgttcagtagtggtcctcctttgacatagtttgcatgaatgaaatcagttgttccactgaaaatttggattttgattgaatttttttcaactttcaactttgctcactatgtactcttggctgtatacccttcttcctgcaaaaactcgtgttcatcggagaacattccatttctcagttcatttcgatcatcaagccggcctaaaccatcattcagcttgaccctcgaaaactctgcacaaggtaccattttactgcgagctttcgtcaggtaattcgcgttgaatgcagtttgcaatgattcctcatctgacaactcattgctcacaaacattcgatcgagccggttgaactcctgcacaaactctgtgaggtggcaactgaacttccccggctcaacaagcagtgaccatttcactttggaggacatctcttcagaaaacttggcgattcgagcagccaccatggagacatgctccggattcaattgaccccaattgcaaagcggatcgctctggaaatattttaatatttttctagtaaatttgaaaaattataaaaccatcttattctgataaaactccgccgctgctctctgaagcactgagctgcaatcagacatcgaagggacaagccgatcacggagccaacctgccattgagcttctgaaaaattaattcattttgctcgatttattctacgaaattatttttacccatatctatgagctagctcatcatgattaattgttggatattccttcgcgttcatcaacttctcgacaagcaaaattctcgtctcctcatcacaaatgatcccatcgacacggaaaagcttctgggcgatgaatgtttgcagttcttcgagctcatgctgctcaacacgctccattaacagctcttcttccgatttctgtccaccgaaccatccacttttcttttccggctgaaaattatttatactgattttttaaagaatttaattactcacagcttttggtgtcagatgaccttttcgtcgattggctgagtggacccacttctcgttgattaccgcatctttgaactcaatactgtcggatcgagccaaattcgagagcggaagatgact