Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F45E12.3   

sjj_F45E12.3 RNAi JA:F45E12.3
Simmer:F45E12.3:Repeat_a
Simmer:F45E12.3:Screen
PCR_productsjj_F45E12.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF45E12.3 Source_evidenceePCR969WS150 Sequence/Annotation Release
Overlaps_Gene F45E12.3 Source_evidenceePCR969WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII73024527303626
Overlaps_transcriptF45E12.3 Source_evidenceePCR969WS150 Sequence/Annotation Release
WB_DNA_textsjj_F45E12.31175attttgatttccagcgaacgcgaatcaaaatgatgttgcgatgggggacaccaatattgatagtaagtttattcttcgataggtgttatattttgtttgatatccaggtacagacggatcagttggtagagattgggctgttctttcggataatgttttcgctattcttgaagataggaaaacagtaaccactttggaaggcttattcagcgtaagtttttgattgtttaaaacattgtaaaaactgagcgttttcagaaggtcagatctgtgtgcgataaaaatcaatcaaaagtactttacgatcgtctcgttgcaattgttgttcagtttgcaaaatcattaaaggagtcgttaaatgcggttgagcaagttcctcttgcagaagacaattgtgagcaatatttggaaaagtttgggcagatctggcaagcatatccagttaaaatcgtaagtgaagagttttatttaaaaaaaaacaatagatttaactcagaatctcatcaggaatatttttcttcatctggaccgaattgcgctcggcgctacagacacagaaattctccctttgtgggaatgtttcatgcaaatatttcaaaaaacattcttcccgaacattttcaaggaattcaaagcaacaaaactgttcaatgctctctatatggcgatgcagaaaattatgcagaggtatccagtggacagtcctctcagaagtcttgtagatatgcttcaaacagttcatgtgtctgaagaatttgcaaaattccttattagccaacttcgagagcactataacaatgagagaatcgataaagttccaaaaatgaatgtaggtttttattttcattctttgaaaaatctcgattacttatatttattttagtgcaacgattacatggaatactgtgaagaccagataaatcgatattcgcaattagtgaaagtgaactttgatgaaccgtcggctctaaaagatgttcaggcaacagtgacaaactgtctcattcaacaagcaattcctgaaattctcacacatgattttgacgatcttatcgattctgataacatttcggatatcggccgaatgtttaatttgtgccgtcaatgcgttggtggagaggatgaagtacgtacacaattctcaaagtatttgaaaaaacgcggagagaaattga