Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F45E4.6   

sjj_F45E4.6 RNAi (5)
PCR_productsjj_F45E4.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF45E4.6 Source_evidenceePCR724WS150 Sequence/Annotation Release
Overlaps_Gene F45E4.6 Source_evidenceePCR724WS150 Sequence/Annotation Release
Chunk_score Abs_score619
Max_abs_score619F45E4.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV76309897632050
Overlaps_transcriptF45E4.6 Source_evidenceePCR724WS150 Sequence/Annotation Release
WB_DNA_textsjj_F45E4.61062cgttgcaggaaatccgtaattgtttttcttactcgttcatacttcttatcatccactgcatcagcttcagtatagatacaacctccaagtttcccgacaaatgggtacaaatcatagagtgtgaaatcgatacgatccgagtgtccaacaacttgtgatatttccatcaatttttctctgaaaacaatttcaaataacaactcaaaatttaaaatatttactaaatctaaacatactgtttcctgtcatcctggtaaatacaagttatgcaaaagaatatgatgaacaagccgataacgaagctggctagcacaaatggaaaaagattaaggtaccaattaccccattttggacctggaaaaagaagaggatcaaggttaaacttgatcgtagtatgtgtcaaagacacgccaaacttgtgctcaagctttgctaacttctaaaacaagttaatatttttggtcaaactcggtctagaactgtcacaaaaaatgaatcacgcgtttacacaattgaattccattaacaactgaaactttgtaagttaacttaccgtcacaatgaattccaccgtattgtctgaaacagagacattccactcttccccattcaaccatacactttccataagcacacggattatgcaagttgtatgctgttgtatccggtggactacgaaaaatgcaatcttgaatttgaactcgatgtctactgatcattgtgatatttcctggccgttcgatgacacactcaaatactgtgttgttgaaatttcgggacacgtttttgatttgtaggaggttattcatataatcataatttgctctaaaattatattatttaaaaaaacataaaactcagcgctgcatacttgtcgtcttgatctaatgtctcttcacctttcgaatctgggtatctgatcttccaatacattttttggccctaaattttcaatcttaaatcaaaaatgttttaaaatgcttacttctccagaatttatatcttctagttttgatttggaatcacatgatatggaggttggccaaccaagtgcccagtatt