Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F45F2.13   

sjj_F45F2.13RNAiSimmer:F45F2.13
PCR_productsjj_F45F2.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF45F2.13 Source_evidenceePCR411WS150 Sequence/Annotation Release
Overlaps_Gene F45F2.13 Source_evidenceePCR411WS150 Sequence/Annotation Release
Chunk_score Abs_score369
Max_abs_score369F45F2.13
Specificity_index0.204
Rel_score1
Map_statusUnique_ePCRV85367628537680
K03A1.1 Chunk_score Abs_score147
Specificity_index0.081
Rel_score0.398
F17E9.10 Chunk_score Abs_score61
Specificity_index0.034
Rel_score0.165
K06C4.13 Chunk_score Abs_score302
Specificity_index0.167
T10C6.13 Chunk_score Abs_score213
Specificity_index0.118
Rel_score0.577
F55G1.2 Chunk_score Abs_score89
Specificity_index0.049
Rel_score0.241
F07B7.5 Chunk_score Abs_score302
Specificity_index0.167
Rel_score0.818
K06C4.5 Chunk_score Abs_score322
Specificity_index0.178
Rel_score0.873
Overlaps_transcriptF45F2.13 Source_evidenceePCR411WS150 Sequence/Annotation Release
WB_DNA_textsjj_F45F2.13919gaaattggtgacgtttctaatgccacttgctgcgttttcaatggaaaaggagataacatacagaattgatttcgtagttcgagagaatattatgctttgcaggtgttaactttacagaagttaaaagaagtttttacaatttaatttgtattcaaaatgaagaatgaagacaggtctagataatattcaagttaatggatctttgacatttatttgagatgtttttgacaggcagatcgacagaagtatacgaacaatttaaaacgacgcaagataatatttattcagattggattgaacatgatcggataatagatatgtggccctaaagagggccgttgggttcggtgggggtttgaatcgaaacggtctcaaactctggaaatcagaaatttaagcacgttctcctcggatacgtctggccaattggatgtcctttggcatgatggtgactcgcttggcgtggattgcgcacaagttggtgtcctcgaagagtccgacgaggtatgcctcggcagcctcttgaagagccatgacagcggaagattggaagcgaagatcggtcttgaaatcttgagcgatctcacggacaagacgctggaatggcgctctgcggatgaggagctcggtagacttctggtaacgtctgatttcacgaagagcgacggttcctggacggtaacgatgtggcttcttaactcctccagaggctggagcagacttgcgagcggccttggtggccaactgttttcttggagcctttcctccggtcgacttgcgggcggtttgcttggtacgagccatttcaattggaatccgatagagactgtgaagaaaggagacatgtacactgcatttatacaaggttgtggtggagaggcggggaggtgagagagtgggtgagagtgagtgagtacaa