Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F45F2.13   

sjj_F45F2.13RNAiSimmer:F45F2.13
PCR_productsjj_F45F2.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF45F2.13 Source_evidenceePCR411WS150 Sequence/Annotation Release
Overlaps_Gene F45F2.13 Source_evidenceePCR411WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV85367628537680
K03A1.1 Chunk_score (3)
F17E9.10 Chunk_score (3)
K06C4.13 Chunk_score (2)
T10C6.13 Chunk_score (3)
F55G1.2 Chunk_score (3)
F07B7.5 Chunk_score (3)
K06C4.5 Chunk_score (3)
Overlaps_transcriptF45F2.13 Source_evidenceePCR411WS150 Sequence/Annotation Release
WB_DNA_textsjj_F45F2.13919gaaattggtgacgtttctaatgccacttgctgcgttttcaatggaaaaggagataacatacagaattgatttcgtagttcgagagaatattatgctttgcaggtgttaactttacagaagttaaaagaagtttttacaatttaatttgtattcaaaatgaagaatgaagacaggtctagataatattcaagttaatggatctttgacatttatttgagatgtttttgacaggcagatcgacagaagtatacgaacaatttaaaacgacgcaagataatatttattcagattggattgaacatgatcggataatagatatgtggccctaaagagggccgttgggttcggtgggggtttgaatcgaaacggtctcaaactctggaaatcagaaatttaagcacgttctcctcggatacgtctggccaattggatgtcctttggcatgatggtgactcgcttggcgtggattgcgcacaagttggtgtcctcgaagagtccgacgaggtatgcctcggcagcctcttgaagagccatgacagcggaagattggaagcgaagatcggtcttgaaatcttgagcgatctcacggacaagacgctggaatggcgctctgcggatgaggagctcggtagacttctggtaacgtctgatttcacgaagagcgacggttcctggacggtaacgatgtggcttcttaactcctccagaggctggagcagacttgcgagcggccttggtggccaactgttttcttggagcctttcctccggtcgacttgcgggcggtttgcttggtacgagccatttcaattggaatccgatagagactgtgaagaaaggagacatgtacactgcatttatacaaggttgtggtggagaggcggggaggtgagagagtgggtgagagtgagtgagtacaa