Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F45H11.2   

sjj_F45H11.2 RNAi JA:F45H11.2
Simmer:F45H11.2:Screen_A
Simmer:F45H11.2:Screen_B
PCR_productsjj_F45H11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF45H11.2 Source_evidenceePCR234WS150 Sequence/Annotation Release
Overlaps_Gene F45H11.2 Source_evidenceePCR422WS150 Sequence/Annotation Release
Chunk_score Abs_score380
Max_abs_score380F45H11.2
Specificity_index0.856
Rel_score1
Map_statusUnique_ePCRI1037285510374054
Y65B4A.8 Chunk_score Abs_score64
Specificity_index0.144
Rel_score0.168
Overlaps_transcriptF45H11.2 Source_evidenceePCR422WS150 Sequence/Annotation Release
WB_DNA_textsjj_F45H11.21200aaagtacaaccagcgttaccaaacttttttgctcgcgatgagacccatctattacgggaacacgaaattctgagaatgcgtattgaacaacatatttgacgcgcaaaatatctcgtagcgaaaactacagtaattctttgaattactactgtagcgcttgtgtcgatttacgggctcgattttcgaaatgaatttctccgtattatttttttcatttttttattctaatattttatcgattaataaatgatttccgtaaatcgtcagcagtgctacagtactcatttgttgcgtaatacgaattctcaggattttttgttaccatagtgttattttcatcaatttctttctaataaatgaaaaacatttttaagagttaccgagattttttttaatattccttttcaatgaggagaaaattgtcaatgagaagcactaattgtttcgccgttgcgttcagggcaggactgcttttaattttaaaataatagcatcacgagatcaagaatgcattatttatttgaacacagaaaataaaatgaggaatatgatttaaagaactgatgtaacaataaatattgaaagttggagagattggacataaaaacgggacattcgggactgtgactcgtttctatttggagcgggctcaattcagacgggagtttacattttatatgaatacattttcttaaaatcctccgcggagagcaagaaccagatgaagaacagatccaccgagaaccttgtaatctgctgctgtcttgtcgtcgttcatttgctttccggcgaaaatgagacgctgttggggtggtgggattccttctttttcttcgacctgcaaaataattttcgttggatatttcgagataaaatttagctaaaatggaagttaaagtatgttaccttttctttgattctctcgactcgatcatttggttcgatgtccagctcaatttcctttccagtcaaggttttaactttgatgagcattttctgtaaactgagacgataaatagcgaatattaggtgaaaattaacataaaattttcaaaatactgcgttaacagataaaaagtgattcaaaaacaatggatttaactctaaacttgaaaaaaagaacaaaattcgaagaatgatgagaggggtccggtagagcgcatttggaacgcgagaacgaacgagagagcatgagaatat