Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F46A8.7   

sjj_F46A8.7RNAiJA:F46A8.7
PCR_productsjj_F46A8.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF46A8.7 Source_evidenceePCR111WS150 Sequence/Annotation Release
Overlaps_Gene F46A8.7 Source_evidenceePCR111WS150 Sequence/Annotation Release
Chunk_score Abs_score90
Max_abs_score90F46A8.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1123730211238307
Overlaps_transcriptF46A8.7 Source_evidenceePCR111WS150 Sequence/Annotation Release
WB_DNA_textsjj_F46A8.71006ctccccaagctactattccatctaattccatctaattctcgtcagttattttattttgaactgctttcaacatggtcggtcagttggttggaaaatgcccaccttgcagtcattggaatcaactacaatcagaagaaccggatttagtttttacatcattaatatttattattttattccaatgttaaagtcctttagtgattcacttttccccaaaaagccagagagctagaaaaaaaaagagccaaaaagggccaagagagccactttattttgagccttaaaattcgaagaaaatttccgcaagtatttcgaaaattgagcgagggacaagtttggtcagcaaaacaaattttcgttttgatgtaatttgacatttaggactattttgtttctttttattgtattttgacccgatgagaatctgagcttggtatgatttttttcgcttttatagttttatttctcttctggaaatggttttaactcgagtacaaattatatctttgcttcgagggcgaatcatttctagaaggggtgggagcgtggtgtttctttgcaccatcccttgttcttgcctttcgggattctgtgactgactcattgcacataacaccaaatgctttgaggacaaagcagcattttgaaagggcggcatgtggaagtgttctataatcacttctcatgttgcactgagtggactttggagacgtgcataaagcgcatgactctaaagcccacgcggtctctgagcagggagcgtcacgtccttacgagtatataagccgactagagaataacatcctcagtcgagaaagaccttgcctgctggcgccggacgaaaggaagactctcgtcgtctggcacagcaacgactcaataaatgctttagcacacaatcaaagtgtttttgcatgatgtttaaccataagctgtggcaccggcttatgaccgttaacacatacaccacaagatactattttataggacacacactcggatgact