Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F46A9.4   

sjj_F46A9.4 RNAi JA:F46A9.4
Simmer:F46A9.4:Screen_A
Simmer:F46A9.4:Screen_B
PF:GL1_3A2
PCR_productsjj_F46A9.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF46A9.4 Source_evidenceePCR525WS150 Sequence/Annotation Release
Overlaps_Gene F46A9.4 Source_evidenceePCR622WS150 Sequence/Annotation Release
Chunk_score Abs_score496
Max_abs_score496F46A9.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI94693709470527
Overlaps_transcriptF46A9.4 Source_evidenceePCR622WS150 Sequence/Annotation Release
WB_DNA_textsjj_F46A9.41158cacatacaggtgtgcttgattgttttgtagtttgagcatcaaccaaattcgaaatatattcaaatacaatttttctggctaaaatttttcgatgactaccaataagtagcagatttttattgacgttgagaattcattccagtatctttttcctgtattctcaatcattcttcttattattttagttatagtttttctattttgcagatattctgatagaattccaacgaaaccattgctttgttttttccgcgtggtttttgtacacttctctcgttagtgaccctgtcacaactaattttaattccagtcaactacaacacgatggctgaccaaaaggaagcatccgaagcagcaaagaaccgcgaaatcaagatctcgtcttcggatgatgaaatcttcttggtaagctgaaattcgtttgttattgtcatttttatctgaaaaactaggcttcgggtcgataagacgctttcgcagttcttatagaaaatgtttagtagcctagttgatttttaataaatcaacaaaaaaagcggcactgtacgctagatggcatgggaaaaattgcaatctgaacttccaggtcccacgcaatgtgatccgtctctcaaacactctcaacactcttcttgtggacctcgggctcgacgacgatgaaggaaccaacgctgagccaattccagtgcaaaacgtcactgcctcgattttgaagaaggttatcaactggtgcaccaaacaccagtccgacccaattccaactgaagacagtgagaagaaaacggatggttccatccaagactgggacaaaaaatttctcgatattgaccaaggaacccttttcgagctcattttggtaacttgttattttagttgcaatattttaaattcctattttcaggctgccaactatttggacatcaaaggacttcttgatgtcgcctgccagtctgtcgccaacatgatcaagggaaaatctccagatgaaattcgtcgtgctttcaacatcaaggacgacttcactgcagaggagagagagcaaatccgtaaggaaaacgcctggtgcgatgattaaatctccatcttttcccctgttaaactttcaattaccttgttttctaaatgtttcacatcatccaccatatctttccccttatt