Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F46A9.5   

sjj_F46A9.5 RNAi JA:F46A9.5
Simmer:F46A9.5:Screen_A
Simmer:F46A9.5:Screen_B
PCR_productsjj_F46A9.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F46A9.5 Source_evidenceePCR576WS150 Sequence/Annotation Release
Chunk_score Abs_score513
Max_abs_score513F46A9.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI94713219472339
Overlaps_transcript F46A9.5.3 Source_evidenceePCR544WS150 Sequence/Annotation Release
F46A9.5.2 Source_evidenceePCR571WS150 Sequence/Annotation Release
F46A9.5.1 Source_evidenceePCR576WS150 Sequence/Annotation Release
WB_DNA_textsjj_F46A9.51019gcatcatacgacacactcacattctattcgctcatttctcaacgttctcattctatttttcgttgtttttctttgttttgcaggtattttgcgttggaaaatttaaaacttttaatttttctcgatggaaatactcttaatcgttcttttttttttctacctgttcttctttattatttgtatgtaatcgttcttttcacaataatttctcaatttcaatcgatttcaacgcgatggctgatcaaaagaaagtatccgaggcggcaaaggaacgcgaaatcaagatatcgtcttcggataacgaaatcttcttggtaagattcaaattattccttcgttttcgttatttttgtctaaaaaaactaaatcgataagccgtgctgcatgcatgcgcgcgtagagttttgcttcttggtatcctaggtgatctgacttatagaaaaatagacaatgttaaatgttccactatatttgaaaattcacaaactaaacttccaggtcccacgcaatgtgatccgtctctcaaacactatcaacactctcctgatggatcttggactcgacgacgaagaaggaaccaacgctgagccaattccagttcaaaacgtcactgcctcgattctgaagaaggtcattagttggtgcaaccatcatcactccgatcctatctcgactgaagattccgataaccgcgagaaaagaactgacgacataggcagctgggacgtcgagtttcttaaggttgaccaaggaacccttttcgagctcatcttggtaacttgttattttagttccaatatttgaaattcatatttttaggctgccaactatttggacatcaagggacttcttgatgttacctgcaagactgttgctaacatgatcaagggaaaatctccagaagagattcgtcgcactttcaacatcaagaacgacttcaccccggaagaggaagagcaaatccgcaaagagaatgcctggtgcgaggattaaattacccttcagtttgcctatttctc