Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F46B3.16   

sjj_F46B3.16RNAiJA:F46B3.16
PCR_productsjj_F46B3.16
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF46B3.16 Source_evidenceePCR633WS150 Sequence/Annotation Release
Overlaps_Gene F46B3.16 Source_evidenceePCR633WS150 Sequence/Annotation Release
Chunk_score Abs_score546
Max_abs_score546F46B3.16
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV2063221320633385
Overlaps_transcriptF46B3.16 Source_evidenceePCR633WS150 Sequence/Annotation Release
WB_DNA_textsjj_F46B3.161173ttttgaaacttgggtggagataattaggaggagtctgcaaataatggttttaaaaacagaaaagcttgtaaaggcacctggaacacaagttgtaattccatagcccgagacacatttcagtccaagagggcatcgcgcagtgaggcatggattgacggggattgaatctttaaatatagcattttgtcttttaaaaaattctaaatctaatttttaccaacctgccatacagattgccacagaagttttgcgaaaaatggctgaaacggtgcgactacaaagttaataaattgacaataaaaatggtaagacacgcatgagttacttctacaaatatcaagttctagacccactatccaagagacactagcggcatcttgagtcatccaagctgtgaagaaatccaccttaatgtggcaaattttgagactgtcgattggtggcttcaaagatgtccggcacaaattgaaatgcttgttattgatgatagctggcaaggtcaaggacctgttttgtacccgttggatttcatggacagaccacaggtatgtgctattactattaggtatttgaaaattaaatatgcggtatgaaatttagaaaaaaattgttataaagcaaatttcaggtagtgaatgctggctgcctgttcctgagtcgggccatacctgtgacagatgaacaattcatgaacctgaaagctggatcagtgagcattaatagcaaaagtattaccgatagatgcataaatcagttcatcaaggtgaatacttgaaacaaattaacatcttcaattgaaatcacatttcagaactgggttaatgggaaatgcgtcgaaagtttcacccaatacactttcaaatcacaagcgatggaacgagtgaccgcggttatcctgcaaggagttcagcaaagcattgcactttctggcccggatcagtaagccttgtgttcttatatttttctaaaaattccaattttgcagatttttttgttgctcctgtgaaaaaccatgtggtcgtggtgattattatgtgattccgagccttgtcgatcccaacgactacatcagcgtgttcttctgtgcgcactacatggtgatcgctttcaagggagccgaacaagagagtcttattcgatcggccggattctgaaactattgatccgaattgc