Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F47B3.6   

sjj_F47B3.6RNAiJA:F47B3.6
PCR_productsjj_F47B3.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F47B3.6 Source_evidenceePCR799WS150 Sequence/Annotation Release
F47B3.1 Source_evidenceePCR799WS150 Sequence/Annotation Release
Overlaps_Gene F47B3.6 Source_evidenceePCR799WS150 Sequence/Annotation Release
Chunk_score Abs_score697
Specificity_index0.494
Rel_score0.975
Map_statusBest_ePCRI39655323966729
F47B3.1 Source_evidenceePCR799WS150 Sequence/Annotation Release
Chunk_score Abs_score715
Max_abs_score715F47B3.1
Specificity_index0.506
Rel_score1
Map_statusBest_ePCRI39727163973913
Overlaps_transcript F47B3.6 Source_evidenceePCR799WS150 Sequence/Annotation Release
F47B3.1 Source_evidenceePCR799WS150 Sequence/Annotation Release
WB_DNA_textsjj_F47B3.61198gcgtccaaaagaccctgatatatatttgtttcaactttcaacgtttcaggtaccaggatgttccatgtcaagacaagggtcgaattgtcgtcaagttccccggtctggcatcggactacatccatgccaactacttgggcacggccaccaaccccaagaagttcatctgtgcacagggcccactggagaacacccaacattcgttctgggcgatggcgattcaggagaaagtggagtgcgtgatcatgctgtgcaattgcatcgaaacgggcaaaataaaatgccatcagtattggccattggagcagggccagaaattagttttcggcgaggcaccgaacaccatttcggttgccaacttgggtgctaagaaaatggcgccggacgagcaatgcatcaatgtaacgactttgaaagttgactggggacaaggctcccgaactatccagcatcttcaatgggagaattggccggatcgtggagtgccgcagaccaacttgacagcaatagtttgttcagatttattagagtgttattttaattctaaaaaattccagaacctcctttcggcaacccgtggcaaccagaatcccattctggtccactgctcagctggaattgggcgcaccggaaccatcgtcgcgattgcttacgttcaagataagatgatggcaggggtaaacacttgaaaatttaaatttccaacctcgaatatttgttttaaggaaaactgcatggcgatgaacgaattgatcaaggaactccgctctcaccgtccgtggtctatccagaacgaattcgtaagacctctaattttaaacttttcattaacaaaacacatttcagcaatacttgtacctccatcgtgtgctgctctcgtatttcttggagcgctacaaggaaacttacgcggagttgttggttggagattatggggaaaaatacaagaaatgggcagacgactatgcagctgccaccgcgaccaagtgatgtagaatgatgagacttttggaaatagtactttttcgtaactatgtagaatgaattattggtatttggatttgttttttattgcatatagttttaaaatgcttatagcgagaactcaagttttcaattttctgctaattcgcgatgtgcgcaatgtgctcatcacgatgcaggtccagaatgatgtgtccttttgcgagttgtgttg