Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F47B3.7   

sjj_F47B3.7RNAiJA:F47B3.7
PCR_productsjj_F47B3.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF47B3.7 Source_evidenceePCR744WS150 Sequence/Annotation Release
Overlaps_Gene F47B3.7 Source_evidenceePCR813WS150 Sequence/Annotation Release
Chunk_score Abs_score750
Max_abs_score750F47B3.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI39690193970109
Overlaps_transcriptF47B3.7 Source_evidenceePCR813WS150 Sequence/Annotation Release
WB_DNA_textsjj_F47B3.71091aaaatgattgccagattccggtgctccaaaaaaactaacaattgcacccatattaatcggtggagcaccatgatccggccagttagtccactgatagtgagtgatggatcttgttttaccggcccatacaagttccaaattagtcacattgataaaatcatcatctggtgagagtgtcccgacgcccaaattgttgatagtgatggtgtggcccttgctgacatatgtattggtctgaccttcgacagctggccaatattgttcgcacttcactctggccaactcaatgactttgcacaacatgataatcgattcgacgttatcctgaatcaccatggcccagaaatcatagatggtagaatccttgggaccttgtgtacaaatgaactttttcggtttgatgctaatgcctacatagttggcatgaatgtagtcactgcttgcaccatcggtagtaagaatgactcttgttttttcaatgcatttaatgtcggtgtacctgaacataaagtttacgaaaaatatagaaaagtataaaaatcacctgttcttttccggatttgacttaaatgcatctacgggaacatttggattcttgttggcaacttcactgaactcgtcgcgaagtttagacacgcccttgttcaaggtatggtgaacccatggtctaacctgaaaatatgaagtttggaaaaaacggagattttctgaaagaagtagtaactaatcaaactttaatatgaaaaaaattaaaattctggcaactcacaatgctaacatgcatccgtctggattgcgcagtgttcggccaaacaatcgattctggatagtcacgctccgacgaagtatcagaattttctctactcaaaattggagaaactcgatcgctttcgtttgccacgacgcactttctcgaaaaacacatttctacaggattcagaacgtagaaaatgcacaaaaaatgtgtagaagtcttcaagtagtaaactcgagaaataaattaatttcaatcagtctgtggaaatatgctttttttggtttatttttttgttgttttgtattcttattaggggcaagggtgtcacgatagt