Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F47D12.4   

sjj_F47D12.4 RNAi JA:F47D12.4
Simmer:F47D12.4
PCR_productsjj_F47D12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F47D12.4a Source_evidenceePCR708WS150 Sequence/Annotation Release
F47D12.4b Source_evidenceePCR705WS150 Sequence/Annotation Release
F47D12.4c Source_evidenceePCR702WS150 Sequence/Annotation Release
Overlaps_Gene F47D12.4 Source_evidenceePCR775WS150 Sequence/Annotation Release
Chunk_score Abs_score670
Max_abs_score670F47D12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII62805106281905
Overlaps_transcript F47D12.4a Source_evidenceePCR775WS150 Sequence/Annotation Release
F47D12.4c Source_evidenceePCR702WS150 Sequence/Annotation Release
F47D12.4b Source_evidenceePCR772WS150 Sequence/Annotation Release
WB_DNA_textsjj_F47D12.41396aacatctgaaaatccgtgaaaaaataacgagtaacaatgaattctggttacagcgcaaacatttttcccagtagctcatcgcccactctgtatcagagtcaccaacttgtaagttcaagttttaattaagattaatttaaaacattaattatcttgaccaacatgctgcaaagttatcagttgtatttgtttataaaaaacacgataatgtaaactgaaaattgtagttcgaaatgctatagtataaacatcaatagatatttatactataaacatttgtattcttatgcatgttatagatgaactaagaaaaattagattttcagtataaaagtcagtatcgttaaaacaaaaaagtgatcaaaaaagcaacgaaaaattaaaacaataatttgaataaatcttccagcagccgaatccatcagcaacgatgtatcaggcgaccccccgggatatgggtaaacctccagtacgaggcaagacatctccatacggattctttgtgaaaatgtgctacgaagaacacaagaaaaagtatccgaacgagaatgtccaagtgacagagatttcgaaaaagtgctcagaaaagtggaagacgatggttgacgatgagaagagacgtttctatgaactggcacaaaaggacgccgagcgatatcaggcagaggtgagtgtacgtttttcattcttaatttattgtagtttagtgtgacagattatatgagaaatgattttaaacaagaataatatttattttcaggttgccgcttacggaggagaagatgcgatgaggaagaggaagcgtgccaagaaggatccacatgcaccaaaaagagccctgtaagttttttaaagttgaaaataatacatagaaattttgaaatatattttaatatttgaaacattgctagttgatttcaaacaaattttaatattaaatatcccattagcgaataagttccaaagaagaataatagattttaaattttctatctaatcatcacacatcctacttttttcagctcagccttcttcttttactcacaagacaaacgtcctgaaatacaggcaggtcatccagattggaaagtcggacaagttgcacaggagcttggaaaaatgtggaaactagtgccccaggagacgaaggatatgtatgagcaaaaagcacaagcggataaggatagatatgcggatgtaagaattttcaaaagaaaacaaacatttatttattcgaaataattacaggaaatgcgcaattacaaagctgaaatgcaaaaaatgtctggcatggaccattatgacgatgataacatccatcatgttgtacatgttgaagatattaatagtcaaaatatctcgtaatcattccaatttgttcgatttttgtacccct