Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F47F6.1   

sjj_F47F6.1 RNAi JA:F47F6.1
Simmer:F47F6.1:Repeat_a
Simmer:F47F6.1:Screen
PCR_productsjj_F47F6.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F47F6.1a Source_evidenceePCR497WS150 Sequence/Annotation Release
F47F6.1b Source_evidenceePCR461WS150 Sequence/Annotation Release
Overlaps_Gene F47F6.1 (3)
Overlaps_transcript F47F6.1b Source_evidenceePCR461WS150 Sequence/Annotation Release
F47F6.1a Source_evidenceePCR519WS150 Sequence/Annotation Release
WB_DNA_textsjj_F47F6.11380attgtttctagtctcccgaggtcaagagagaaagagacaatggggggtcaaggtggccgggtcgctactcagccaatttggttttttgtaaaaaattgttagcgtaaggtgataggagacattatcagctacaaatttggaatttagcctgtgcctttaaaattaatatgagctgagttatagaccttcgaaaattgttgtcaaaaaaatttccggaaaatttttgccaaatttggaaagtacggcgttttgccaaaaatagggggatttttacgaaaatttgggttcaagtagagtttaatataaaaaattcaaattttattctataaattgctttttagcccgagaatttttgataacttctagaaaagttacagacattcgaaaatttctgccaaaaaatcttcctgagataatttcgctggtacctagtttcgccaaaaatagcggaatttttacgaaaatttgggttccgatagaatttggcatggagaattcaaatttcttatttaaaaataactcagaaaattctctcacctgcaccaagtgtccttgtactcgtcttcaaatcgcttggtgtgcagtgtcagtgcttctcgggtcagtggcgtctgcggtgggtacttcctgaaaaaaaaattatttttttggtcaaatttatcggaatctgttgttgtttttgtttatggcaagtgtcatgcccgcgcgcgcgcatcctatctctaagaaagacggagataatgcgtttgttttgacacactgcctcccggccagtcgggtggctggtaccgggtaccccccttatctgagaggatggtccttatagacaattgtgaaaaaatctaggctctattaatagtctgaagatggcctataaactcaaaaaaaactcacttctcatcgaacggctcatcttgtttcgctgggctttccggcctactctgagacttcaacaacctgtgcacattctccagacagttaatctgtgtgtagctgagtggtgggtccgttgaggtggtcggcggggcgctggcaactttcctgatctgggcggtggcgactacggcggcctgggctgcctgagcggctgcggcggcggcgacggctaccttctgctgttgctgggctgtggagttgacaacgagttgctcgacaattttgtcgatgtaggcgcccaggtcgatgttggccgggaagccctggttctgatccttgaggcttgagtgatggtggtggtggctgtgacgggaggtggatggtactggctgaaaaatttcgataataagaatgggaaaataattttttaaatagaaaacccgaacctctgcaagatcgtacaagtagcttaaaatatccattttagggtggtaggcttaggag