Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F47F6.1   

sjj_F47F6.1 RNAi JA:F47F6.1
Simmer:F47F6.1:Repeat_a
Simmer:F47F6.1:Screen
PCR_productsjj_F47F6.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (2)
Overlaps_Gene F47F6.1 Source_evidenceePCR519WS150 Sequence/Annotation Release
Chunk_score Abs_score435
Max_abs_score435F47F6.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII12351311236510
Overlaps_transcript F47F6.1b Source_evidenceePCR461WS150 Sequence/Annotation Release
F47F6.1a Source_evidenceePCR519WS150 Sequence/Annotation Release
WB_DNA_textsjj_F47F6.11380attgtttctagtctcccgaggtcaagagagaaagagacaatggggggtcaaggtggccgggtcgctactcagccaatttggttttttgtaaaaaattgttagcgtaaggtgataggagacattatcagctacaaatttggaatttagcctgtgcctttaaaattaatatgagctgagttatagaccttcgaaaattgttgtcaaaaaaatttccggaaaatttttgccaaatttggaaagtacggcgttttgccaaaaatagggggatttttacgaaaatttgggttcaagtagagtttaatataaaaaattcaaattttattctataaattgctttttagcccgagaatttttgataacttctagaaaagttacagacattcgaaaatttctgccaaaaaatcttcctgagataatttcgctggtacctagtttcgccaaaaatagcggaatttttacgaaaatttgggttccgatagaatttggcatggagaattcaaatttcttatttaaaaataactcagaaaattctctcacctgcaccaagtgtccttgtactcgtcttcaaatcgcttggtgtgcagtgtcagtgcttctcgggtcagtggcgtctgcggtgggtacttcctgaaaaaaaaattatttttttggtcaaatttatcggaatctgttgttgtttttgtttatggcaagtgtcatgcccgcgcgcgcgcatcctatctctaagaaagacggagataatgcgtttgttttgacacactgcctcccggccagtcgggtggctggtaccgggtaccccccttatctgagaggatggtccttatagacaattgtgaaaaaatctaggctctattaatagtctgaagatggcctataaactcaaaaaaaactcacttctcatcgaacggctcatcttgtttcgctgggctttccggcctactctgagacttcaacaacctgtgcacattctccagacagttaatctgtgtgtagctgagtggtgggtccgttgaggtggtcggcggggcgctggcaactttcctgatctgggcggtggcgactacggcggcctgggctgcctgagcggctgcggcggcggcgacggctaccttctgctgttgctgggctgtggagttgacaacgagttgctcgacaattttgtcgatgtaggcgcccaggtcgatgttggccgggaagccctggttctgatccttgaggcttgagtgatggtggtggtggctgtgacgggaggtggatggtactggctgaaaaatttcgataataagaatgggaaaataattttttaaatagaaaacccgaacctctgcaagatcgtacaagtagcttaaaatatccattttagggtggtaggcttaggag