Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F47G6.2   

sjj_F47G6.2RNAiJA:F47G6.2
PCR_productsjj_F47G6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF47G6.2 Source_evidenceePCR807WS150 Sequence/Annotation Release
Overlaps_Gene F47G6.2 Source_evidenceePCR807WS150 Sequence/Annotation Release
Chunk_score Abs_score662
Max_abs_score662F47G6.2
Specificity_index0.796
Rel_score1
Map_statusUnique_ePCRI14759521478232
Y51F10.5 Chunk_score Abs_score77
Specificity_index0.093
Rel_score0.116
Y39G10AR.18 Chunk_score Abs_score93
Specificity_index0.112
Rel_score0.14
Overlaps_transcriptF47G6.2 Source_evidenceePCR807WS150 Sequence/Annotation Release
WB_DNA_textsjj_F47G6.22281aaagaaattctggaagttttggcaggaaattcaaaataaaaaatatctctgaaaatatggcgcgattttcaaaattcatctaaaaaaactgatttgaagtttacggatttctggcttccctcataaattgaaatggaagagtttttgccgaactaggccattttggctcgaccatatctggggtagatttacggcgcgttgcgtgtcgcgtcgcggctcgattttagttgtaaaactaaatgtatttgtccgtgtggagtacacgacttacccacgagttgtccggcgggcaattgtcaatggagcgcgaaaaattcaatgaggaaggtcagaaccccgtgaaaaaaacatcattgcattgtagccgagttttcttagttttgcggccacgttcaaaaattcttccatcatttcaggtaatgctgtgtgccctagcttgttctcgtgctggacttgtattttctcttgcaaatcccaattatccaaacagttactctttgaaacgagctctggagttggtgagtcgattttttttttgaaatatcgagagttgcaagcgcgctctgctgaccaattgtgtgaaaattgaaaaacttaggattttttggcccatattttgacgcgaaatcaatatttttaaatttcaatttttagagcattttttcaagaatttgaaaaaaatttccagggagaattccaatgtattgtttgcttccgagcacatcaatatgaggcggatcacttgaacaatttgttgctcgaaattgcaccagaattgatgagaagccggaagggacagctgaaaagtgaacttttgccgaaattgacacatgttattttggcggaagaggatcacaaacatgcgtgagtcacaataaaaaaatgttgactaaaaaatgtaaaaatttcgaatttttggattaaaaaataattttttaaaaaattatataaaaggataagcaaatacgctctaaattaaaaaaaatcacaaaaaataaaaataaaattgttatattttcagcggaaccttcacattatcggaagtattcctcaaatcctcaaaggaaaaaatcgcgaagcttcccgatttcagtaaatggtcaagccacaagctagcatgcctccagtttacgctggtagatcaaaaattatcaatggagcgcaattgcacttttttttttcagggaaccactggagcacccaagttgattgccttatcacattatcaaatgctcaatggagctagagcagttgcagcggcgtttggaattaatgataaggtagggagtgatggcctaactttttctaggccaccgtggagcacgtggtatcagagtgtcatttcggcttgatctacgttgatctacaaaaaatgcgggagaagagacgcagagttctcaacttatttcgcatggttagaagaacgtgctgacgtcaaattttattgggcaaaaaattcctgcattttttgtagatcaaaccgcaatgggacagcctggcaccacgtggatctggttaatcttaatttttttaaaaacatattataaacaactgaaaattgagggcctaactttcgtaacagtttttccgtatttctaggccactttggaaaaattagtcctcaaaagtttaaggactaacctatgtcgtggcctatatatttttttttcggatttctaggccagcaccagctaccctaattttataaatttcttgtcagccaaaaaagcaactggcctagttttttcactggttttctattccagtaggtgtggcttaacttttagaccatgacctgtttttcatggcctaacttttcgaacttctaggccgccaccagcaactttggcctagtttccttaaaatttcctcttccagcacgtgttggcctgcgctcttccgatcttccgaattgcgatcttcaatctgatctgcctgtccccgttcctcaccgaatgccgtataatcttcccagacgcgactccactgccaaaaaatttattctcaagtgtcagtaaatacagatgcacaactcttttatcaaatggagctgctcttcggctcttgctcaaaatcagtcagacccagagggtgaagctctccgcgttggagaatattttattgattggtgatcgtgtctcgaaagaggtgttgaagcttatcaaggtgcaagcggagaacgtgaaaattattgcggtgagtattctcgtggcctggatatttttctaggccaccaattatctagtggcctaaattctctgagttggtccctgataaactg