Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F47G9.3   

sjj_F47G9.3RNAiJA:F47G9.3
PCR_productsjj_F47G9.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF47G9.3 Source_evidenceePCR1054WS150 Sequence/Annotation Release
Overlaps_Gene F47G9.3 Source_evidenceePCR1054WS150 Sequence/Annotation Release
Chunk_score Abs_score970
Max_abs_score970F47G9.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1131731311318502
Overlaps_transcriptF47G9.3 Source_evidenceePCR1054WS150 Sequence/Annotation Release
WB_DNA_textsjj_F47G9.31190cactgttgcatttcccacactttccacgttctgtgttacaacaactacagtctcgtaaatatctccgtttttagtgatacaagttgtatcattatgacggatctttagaatcgcttctccatccgttccaattgtttttgaacaatttgagtgaccatttcgaacgtaaatttctccaccaacaagattgtgattatccgggtttccaggggaaacttttactgaaataaatccaaaagtacattgagtactaattttcacatcaagtgggctcgatccaagttttgaggattttttgacgtacagctttcctggataaaaaataaattgagttatgtaaaaattagaagaaatactaactttcttcaactttcttctggtccttcttgtttcctgttgagaatgtttttgctttatgaggctttttaactttagaatctcctggtgcaattgtagctaaaactgtatgttttggtacgaattctagaaaataacttactgggtttcagttcttgttcaaaagtgataacgttcaaagtgaataccgagcaatttgtgttttcattgtctgtttcaactgcaccatcatgtaaataacaatcccgtgatttagtgtaactgattgattcgcagctgaaattttcaaagcttaaaaaatatttgtttttatttcttaccttcttgttggatgtgtggcacacaactgcatacattgatgaagttccaaatcttttgatatcaactgtccattttcattcttacatccaccgagttcatcaaacaaaatagcagatccatcactcaaatcattaacatctgcacatatcttttgtgctaacattggcaatgccattcgtcttcttgaaatcaaacaattattcatatctttggactgataagcaaatcgacattcttctgacattgtgcatttttctagacattccgatttcaaactctcatctggattcgaatatgaaatatacaaagagtttcttgaattacaggtctttttttgataagaacatgcatttgtgagtatttgatattcatcattcacaaaatcgagcaattgacctgatggatcattccaaactgagtaacattcggagaatccctcgttgtacatcactacatcacaatccttgcatttttccatacactttccaagtccatcggagccattgaaaatt