Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F47H4.3   

sjj_F47H4.3RNAiJA:F47H4.3
PCR_productsjj_F47H4.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F47H4.12 Chunk_score Abs_score270
Max_abs_score270F47H4.12
Specificity_index0.587
Rel_score1
C38D9.5 Chunk_score Abs_score190
Specificity_index0.413
Rel_score0.704
Overlaps_pseudogene F47H4.12 Source_evidenceePCR719WS150 Sequence/Annotation Release
Map_statusUnique_ePCRV1736884117369828
WB_DNA_textsjj_F47H4.3988taggaaactcgattggcacccttaccaaaagcgtaaaggatttgaagcctatcaaaggatctcccatgtttagtgactttgagaaaatttacaatagtttgaaagaagcgggtgatggagcggcattcattgagaaaacatataaaagtgtgttatccactgagcacaaggatgtagtatcaattactgtttctgtaatgtcagcattatcaggtgctcaaacccttacagttgcggataaaattttcaagaaggttaaaaaggttagggaagttaaagattttgacaagctcctatcttttatcaatgcggttgttagcaagataaaaccagagttctccgccatttagacgagatctcaaagaccacgtacaactgggattctattgcatctgttcataatagtctggctgacacaggattggtagctgcattgaaaagcttgaaaagtgcaaaccctgatgcgagcaagattgagaaaatgctggagtttggactgaatgttcgggaaatcaagaaaggcgaagttcagagtgtgaagagtatagtggaatcgactgagaagttgaaagcgagtctgacagccatgaaagaagcgatggatcgtaaaggtgcaacatcaaaacccaaaagagcagtaagcctgaagaagatggaaaactctctgtctttgatgaaagagttcgcaactggaataaattctctaaggaagctatcagatgtattggctaaaaaagttgtggtgtcaactgctgcagattcaccaaatgaagttaacagtctgatagctggtttaccggaaatgcagtcatcctggatccaggaaaatcgagacggaatgaaaaagttgttggatgatttgacgatgctggataaatatgcaaaggatcacagcagtaataaggatctcattaaatatggatcaatactctcaaaggcttctgaaataacaggagttccgattgatacgtcgctgatcagaaaatca