Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F48A9.1   

sjj_F48A9.1RNAiJA:F48A9.1
PCR_productsjj_F48A9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF48A9.1 Source_evidenceePCR946WS150 Sequence/Annotation Release
Overlaps_Gene F48A9.1 Source_evidenceePCR946WS150 Sequence/Annotation Release
Chunk_score Abs_score883
Max_abs_score883F48A9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI65945876596057
Overlaps_transcriptF48A9.1 Source_evidenceePCR946WS150 Sequence/Annotation Release
WB_DNA_textsjj_F48A9.11471gcaaacccctatatcccgttccctagtaacacatgatccatctactgggggtattcaattatcaaaaaagaatgcaatgttgaatgatgcagtaacaacaacaactacagttgaagtatttcgtgctccaacaaatacagatatgatctcattaactccggcttcaaatggtggaccacctctgttagtaaggacaaatggtccacaatatgagcaatggaatgatagaagagtacaaacaatgatggtcgatgatgatcgaagagatttggcaaaaggtgttcaatggaaagaacgattgattgaagaaagtgatcgaaggtattgaggaattattagacaattgaatagactttttctttttgatgacaagtttataagtttttgatcaaatttcactaatcttattttaatattgaaaaaataaattgtgttttaaactgaacattaaagttcacaagatcagagaaaatatattgttgcagaatacagctaaaagcttaaaacttttaaaacttgtgacgtaacatgtttctctacagaactgtaacatctaatgtgcgtcacatcttttaaaaataaaattttgtttggattcatgtgttttaaaaatatttttttccagatatcgagataacggcagtgatttctacgacgagataactgaaccaactcaattcattcatcacgactatcgaccaaaaccattaggatttcaaacaataactcatccaattataatgactggatctcgtgatgatcttcgatcacaaccaccgcaatatcctgctccgttaagcccattatatattgttcctgatcgtcatagaaatattgcaaactcagtttctcctggacaatattctagaagaagtaatggatatgaagatagaagaaaagatacagaagaattgagagacgagagaaaacgagaaaatgagcaaaatcaaaatagggaaaggtatgaaaatgttggacagaaaagggtaaaaataattgaatagttgcatttttcatgttttcttactttttggttttttgtggtagttcggaatttttaatttttaatttttttttaaatttagagtattgaaaaaacaacatcttctttcactatacctttacgctacagtgaaggtttcatattccagataccaccatcgtcgatcaaaatcctcaaatcgagatgatgcttctgtcagtcatcgttcacttcgtcatcgaagcatgtctccagcatcacgtcgatcttttggaacatcactcggtggctcacaagagttcgtaattcctgctcattcaccaattggtagcactttaatgctggcaagcccagatccaaatgagcttccagggcgaccagcaagcgcaaaaagtcaagaaatatttgcattgtatcagactagagatgcttataatcgaattgtggatcagttgtgaattgttgaatattgttggttgtgcatgcttt