Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F48C1.2   

sjj_F48C1.2 RNAi JA:F48C1.2
PF:GL1_5H9
PCR_productsjj_F48C1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF48C1.2 Source_evidenceePCR777WS150 Sequence/Annotation Release
Overlaps_Gene F48C1.2 Source_evidenceePCR777WS150 Sequence/Annotation Release
Chunk_score Abs_score683
Max_abs_score683F48C1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI53196025320758
Overlaps_transcriptF48C1.2 Source_evidenceePCR777WS150 Sequence/Annotation Release
WB_DNA_textsjj_F48C1.21157cagaccaaattggctaccgtacccaccaaatattttaatcgaaagtttgttcgaaaattgaaattgaagtattttatttttaattcgatcgttaaagaaaattgttaaaaaatagttttccagaaatatataatgggaaactgttctggcactgcaaaagtcgagctgcttgagtccttcgagaactggaacaagcttccacctgagataaagctggaatgcatgaaacatctagattttaagacaaggtaattgacatgattgaaaaaataataattaaaaatacatttcagattcataatgcgtagtgtttcacgcaccgagaggatcctcgtcgattcacacaatttcaaactcgactcggttcgaatcgaaggtcttttgccgtatcctatgaatacaattattcaatcaagtttcgacactcaaaaaatcacgattaaatctggaaatcatgaacaatgtgtggtccatatgagaaaccgtcttcgatttaatgaaacaatcgtcccactgcttgtcttcattctcaaaaatgcaactatcaatgatttttcgattgaaacaattttgaatattgattggagcaaagttctacaagatgctctcaattcgaagtcattgagcatcagaagcttcagtggagtattgctgaaatttcaagaagcatttttctttgtcaataagctcaattacacttcaaagtcgatttatcttgacggacatggatgtaaaaatttcccaatagatcaactgataagtatagaatcggtatgctcactcgaacaaaaactcaattataccatcctagatttcaggtttccaacgcatcattgttgcaaattcgcgatgttcagagtaaagatattatctggaaaattgcaaatgtacatatttcgaaattccataaatgtgtttaaaaatgtgttgaattttagaaatggatcgagacagatgctgcaattggaacgagatttcagctaacttcaatgagcaaggaaattattacccaattctcatctcatttcaagaacagaatcatgtaagaattaaaatgataaataatatcaaacagcacaaaaaaatattttagggcaattaaagcaaaattccataaaaatgtgaataatacaacatttatttccagttccgcgtct