Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F48C1.6   

sjj_F48C1.6RNAiJA:F48C1.6
PCR_productsjj_F48C1.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF48C1.6 Source_evidenceePCR724WS150 Sequence/Annotation Release
Overlaps_Gene F48C1.6 Source_evidenceePCR724WS150 Sequence/Annotation Release
Chunk_score Abs_score619
Max_abs_score619F48C1.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI53183505319281
Overlaps_transcriptF48C1.6 Source_evidenceePCR724WS150 Sequence/Annotation Release
WB_DNA_textsjj_F48C1.6932atccttgtccctgattgctgtctgacgacggtccagaaggtgttccagacatgaatcctgaatcttcaacaccgtatggcgaaggaattggtggagatgggcggcgagctcgtggagattgttggaattctgatgtctctcctatttctgtcttgtatgaagagaatgaaccgtcgtaggaagaattatcgccagaagaaggaacactgtacgtgtaatcatatgaatttggtttcggattctgaaaattttacgtttgattattagaatttctttttttcagctttcagtaatatgttttacctcaactctctgagctgctgcttcgccatcaattcgcactaaaggaactacgccggctcctctattttggcggcgaatatcttcgtagtttgtcgatgacttggcgaggtcgtactgaaattggccattgatcagatatattaacaattgaatttacttttttccatagttgatcaattcttggcttgatacgatctcggcatgtgcccatgaacatcaaatttgaagcagtgagagaactgaaaaatcaataaattatttcagcaacaaaatgtttaaaaaacatacgcaatccccattatagcataaaatggccatcctttgggaccaaaatgatattgagcgggaaggcgagtacgagctaaatacaaactgccgagaattgctccagttatcggcaatccacgtgtcattgtaacctagaaaaagaaaaagaattaaaatacatgaaactgagatgaaatacctccgtggtgcaagttctcatcatttcggtcaattccttttgttcgtcactggagagtttgttgagcaaagcatgaatctgttcgttgttgagctcaaccttttgagaagaatctcctgtcggttgagaatacataaaaccgtcggatgaagacatttctgca