Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F48E8.7   

sjj_F48E8.7RNAiJA:F48E8.7
PCR_productsjj_F48E8.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F48E8.7a Source_evidenceePCR867WS150 Sequence/Annotation Release
F48E8.7b Source_evidenceePCR867WS150 Sequence/Annotation Release
Overlaps_Gene F48E8.7 Source_evidenceePCR867WS150 Sequence/Annotation Release
Chunk_score Abs_score762
Max_abs_score762F48E8.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII54466375447755
Overlaps_transcript F48E8.7a Source_evidenceePCR867WS150 Sequence/Annotation Release
F48E8.7b Source_evidenceePCR867WS150 Sequence/Annotation Release
WB_DNA_textsjj_F48E8.71119cattggtagctgaccggtttggcggtgaagttgaagtactgacggttgaccttcagattggagcacatttcgaggaaaagctccatgttcgtgtcagagacgcagccatgaacgttgagataaacgagcgaaggcttactgttgaagtgtctggaaatgttttgtttaaataaattaaactaattttcaaataaactcacacaaccatattagggtccaatccgtagcatcgattgagagaaattgtcgtaagtctcgggaatttgttcagaatcactgcgaggcctggatcactaatctcgacgttatccgacaagtcgaggtcggtgacgtagttggattttgcggcgagaatctcaatatctggaattttttacagaaaattagaagattctgacaacagagccgctcacgtttattgttgatgccgaagtttcgaactgttcccgagagattcaactttttgagcttctcgccaatggaatgaatgattacggtcacaattggctgtgttaatccacaccacgccagattcagttgttgcaggctgaaaaaaatattacgaaggtgcacgggaacaagaaatatgttacagaaattatttaaagatacacgtggcaagaacactttcaggaaagttttaaaaaatccctcactctttgcaatttctgaagatcaaactggctccatttgccgtgattccgttggtcatcgagatgtcgagctcgcggagcccgcgattctctgcaatgcatattgccacgtggtcatccaattgatttccttcaattgacaagcatttgagcttctggcatggtttcaacataatctgcatttggcgggcagtgagattagtgcgagagagatcgagaagctccaagcgggaggtgctcagcagtgcaacttcgacgagccgttcatcggcacgaaggattcgatcggcctggaaacagttagttttataggaaataaaataaaattctcactttagctcctgccagacgaagaactttgatttttcgttgtgacaacgcaatcagtgaaatttcggaaataggacgatcctgggcgtcggtgataatccaatttctcgatttgtgtccgattccgtaaaaacga