Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F49D11.2   

sjj_F49D11.2RNAiJA:F49D11.2
PCR_productsjj_F49D11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF49D11.2 Source_evidenceePCR803WS150 Sequence/Annotation Release
Overlaps_Gene F49D11.2 Source_evidenceePCR803WS150 Sequence/Annotation Release
Chunk_score Abs_score698
Max_abs_score698F49D11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1092142010922588
Overlaps_transcriptF49D11.2 Source_evidenceePCR803WS150 Sequence/Annotation Release
WB_DNA_textsjj_F49D11.21169catcaccagaatctcagcgagctctgggagacattgttgagcttgatgacgtttctgatggatatgacgatactctaacaacaactacaacaggagaagggacgtcttccattgaaagtggacattattataaaacatttcgaccagaagatttgtgagtttttgattgggtactgtgtggataaacgccaaaaattgggagggaaaatccagttatgagccattagcctaagcctaagcgttagcctgagcctaagccttagcttaagccaaagcctaagcacaagctattttaatttcagatttgagttaaccatgtgctctgaagaagcaaaagaacaaatccgagagtacaaacttggaatcacaagaatcgcattcaacgacagaaccttcacattctggatggtagatcaaagatttgatcagtgccagacaagtacttgatttttaatctcaaatttaattcaaacatttccagaagttgatatccaaatcatagagcgctctaacttgccgggaaagttgaaacgaatcagcctgtacttgaaatccaaaatttggaggaaattcttgagtcgcaagataaatggagccacctatctggtgtaagttgggattttgtataagaatctgaaaacattttttaactttttcagcgaaaaatcacatcaaaaagagtatgggctggatttgacacatgaaggatttaattatagattgttagtttaaaataaattaagacgccctgtcacttttcaagatacttttcagagctcattgcaacgggaaatactccatctacacaagtgacatgatcgctgcccaccgagatctttttcttcatctcttttatgtttttcctagcaaagatccggtcttttttattgatctacgaggaatccgctccgaagaaatcaatgttactagggatctcattagcattcagcagatcaatcggggatcgtgtctggcaatgggagttcgagaaagagagtttgtggaggatgcacacaagattttggaaatgatggagagtctgaagaatttgaaattggatatcagtttgcgaaaggtcgagtttttcagtccaaaggtgagttctagtgagatggtaaagtttgctataaaggtgataaagctacctagaaaattagggaaggtgcgct