Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F49E11.1   

sjj_F49E11.1 RNAi JA:F49E11.1
PF:GL1_3A1
PCR_productsjj_F49E11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F49E11.1a Source_evidenceePCR866WS150 Sequence/Annotation Release
F49E11.1b Source_evidenceePCR845WS150 Sequence/Annotation Release
F49E11.1c Source_evidenceePCR845WS150 Sequence/Annotation Release
Overlaps_Gene F49E11.1 Source_evidenceePCR963WS150 Sequence/Annotation Release
Chunk_score Abs_score921
Max_abs_score921F49E11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1303300313034018
Overlaps_transcript (3)
WB_DNA_textsjj_F49E11.11016aggattccgatggaacacacaatattatccatatgctcgactatttcaatttccgtaatcacaagtgcatcacgtttgagcttctcagcatcaacctttacgagttgatcaagaggaacaagttccaaggattctcactgatggttagttgttgaattttcaacaaaaaattaattaattattttctttttttcagctcgtgagaaaattcgcttattctatgctcttgtgtctggatcttttacaaaagaacaggctgattcattgtgatttgaagccggaaaatgttctgttgaagcaacaaggacggagtggaataaaagtcatcgattttggttcatcttgcttcgacgatcaacgtatatacacatatattcagtccagattctacagagctccagaagtgattcttgggacaaaatacggaatgccaatagacatgtggtcacttggatgtattcttgccgagcttctcaccggatatccattattgcctggagaggatgagaatgaccagctggcacttatcattgaactactcggaatgccaccaccgaaaagtttagaaacagcgaaacgtgcgcgtactttcatcacatcgaaaggatatccacgttattgcacggccacatcgatgccagatggttcggtagttctcgccggagcacgatcgaagcgaggaaagatgcgtggaccaccggcttcgcggtcgtggtcgacagcgttgaagaacatgggtgacgagttattcgtggatttcttgaagagatgtctcgattgggatccggagaccagaatgactccagctcaagctttgaaacacaagtggcttcgtcgcaggttacccaatccaccacgggatggactggagtcgatgggaggacttgccgatcatgaggtttgttttattattttctagacacgaaattttgcgattttcgctctaaaagtacggtacccggtctcgacacgccttcagagagttctgtaatttcaagttttcgtcgctgcagaat