Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F49E12.4   

sjj_F49E12.4 RNAi (5)
PCR_productsjj_F49E12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF49E12.4 Source_evidenceePCR483WS150 Sequence/Annotation Release
Overlaps_Gene F49E12.4 Source_evidenceePCR483WS150 Sequence/Annotation Release
Chunk_score Abs_score357
Max_abs_score357F49E12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII84055548407031
Overlaps_transcriptF49E12.4 Source_evidenceePCR483WS150 Sequence/Annotation Release
WB_DNA_textsjj_F49E12.41478cgagttttggattcagaaaaatgcattagaattatgggaaaaattgtgttattttgaaatttgagttattttacttataaaattttctatctgcaagatattttaagttaaaataaataaatccataaagctttcaagatttggacataatttggtggctgaacaagaacctaactttaaattccaggtagctttaagaacataaattatacttttacaaaaaaaagtattcctaatattttttgaaatgttttttatttatataattgaaatccttaattagcttttctaattttacgtgttctaagttaatctatcaatttttgatatccatattctaattatatccatattctgaatcattcctactttcattttacacgatgagcacacttcaagcagctgctcatggaagaattgttcaactatctcgtatcagaaaggtacttttgaaaatccggtcagtttcttaagcgcttttcaggaaattgccgatctagcaaaaaataagcgacgttttatcaaggatttccgaaaaattgaaaagtgcaaggatatcttccaattcaaaattattggtgtgagtctaactttcacgttttcagaaacatttaatttttcaggatggagttctgtacaagaatatgattttcacattgactctagatgtgaatgtcgaatatccattcaaacctccatatttgaaattttgccataatgtagaaaacgagataatggtatttccaatgttgagttttctaggtctatcatccaaatgttgatccagttacgtgtgaactttgctcgcccatgctacttcaagagaattggaaaccggagaccaccatggaagatggtaaatattatcaaatgttctgcaattttacataactacgtttaatctgccattgaaagaaagatatcgaaaagactttatacttttcctacaaaatttttagctgacaatttagagtttgatatttgttgaactctatctaacatgaacattataatcccaaatttcttattatttaattttctttcagtccttctgaacctgattgttttgctcaatgagccggatctctcacgtcctgtgaacatagacgccgcccacgattatatccatgtaattttttgggtttttgcacattcatttattatttttcagaacaaggtggaattcgtgaaaaagtccaccgaattggcaaagaaatggaattgaagaaactgatttgtgattaaaaatactgaaatttttgtataattttatagaaaataaagtcaatattcagttgttttactttaatttttcttttcgaatcggttatgtgttttcgaatcggttactgacagttttatggttctgccggttgttttccgagaaaatgttggggaacaggtggattgatatttgattggattttctcaaattcaaaaagtgattgaatttctgaactggcaaaaacaaaaagttg