Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F49H12.i   

sjj_F49H12.i RNAi JA:F49H12.i
Simmer:F49H12.i:Repeat_a
Simmer:F49H12.i:Screen
PCR_productsjj_F49H12.i
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF49H12.1a Source_evidenceePCR921WS150 Sequence/Annotation Release
Overlaps_Gene F49H12.1 Source_evidenceePCR1009WS150 Sequence/Annotation Release
Chunk_score Abs_score841
Max_abs_score841F49H12.1
Specificity_index0.699
Rel_score1
Map_statusUnique_ePCRX20902002092811
M142.7 Chunk_score Abs_score324
Specificity_index0.301
Rel_score0.43
Overlaps_transcript F49H12.1a Source_evidenceePCR1009WS150 Sequence/Annotation Release
F49H12.1b.2 Source_evidenceePCR921WS150 Sequence/Annotation Release
F49H12.1b.1 Source_evidenceePCR921WS150 Sequence/Annotation Release
WB_DNA_textsjj_F49H12.i2612gggtttcctgaagaagatgagatggtggaaggaatgatgacccctcgagctgtgcaccagtgtaatgtttgcaacaaaatatttgtttcctataaaggtaattttttgaaaaatacggtagctttgtctaactctgattttgttttcaggtctccagcagcatgcagtgatacacacagatcagaagcctttccgatgtgatatttgttcaaaatcatttaggtttaagtcgaacttgtttgagcatcgttcagtccataccggcttcactcctcacgcctgtccatattgtggaaaaacttgtcggttagtggtttttttaaacaacattcgctgtgctctttcaaatgtacagtaataaaaatgtggcgggttgcgaaaacgaccgtttccccttaattctcattctctcacagtcgactctcctctgctaatgcgcagtacggtgtgtacagtgtacgggccgagaaacggtagagaaaaagagacggacgagagacaccgtaatgccataggcgacactgtagaacaatcgataaaacgaagagaaatagtgttagaatggtgaaaaaggcgtagataagatgcatgccgtactcatttcaaaacggcactcgtgacagtaatctaaatgttgcgggtagaaaacacaaaaatataatcaacaaaaattatttaggcgatacgagaaataacaaacaaattttttaaattttttcagactgaaaggcaacctcaagaagcatcttcgcacacacgtcacgacgaaggaagagctggaagctgcctggaggccgtttgccaggtttgatcttaacaaaaacggaacgccagtattggcaaaatctcggttcagcaaccgtcggccgcctgctgacatccctgacgacgccatcgtacttcgtggagccggaggaccgtactacacgccgccgcctcgtccgaagaagaagtaagcagacatccagcatgcacaattaaaatgtgagattaccgaatgttttttttcaggaagcttggactcggagaaccagagcactgggtggacaagttgagaagaggagatcttctgccacaagttgagcttgaggacaagatcagacgtctcgaagacactatcttcaacaacatgtctcttgagcgttggggcaaccttttcgagattgcaaagtccattgcattcgagacgtgagtttatttatccttgaactgaaaagaaatcggagtggaaaatgccgtttgagcacatgaattctcagaattacggtacatattatatacatacctgctctccgtgcgtttgagaaagatttgacatcaattcaaattttttgcaacagtttcgctacgaaatttcgtcaaattttgattgaattattatcttaaaagagagcgtactttataatttgttttaaaatggctggaagattgttgaaagcatagaaagcatcaaaaagtgaatgtaggactgaaagtgagtataagtataatatctgaaaagcgctcggtgtgcggcaaatttgccgaatttgccgaattcatcgaattccgtaaatttcaaaaatgtagacttgccgaatctgccgagcccggcaaatactgaaatttgccgcacacatgaaacaatttttataaaaattttgtacaaaactaatggttttgaacagaaacctaatgaaagtaaacataacatcgtgtttcttttattttttattgaagaaatccacacgcgcattaggcaaaattcgaacaaaaaccagtaaacgtagtttattttttaaatcaattttggccctctttgagctcgaaaaatattgcgatttactgagtatgacaaccatggcaaatttgccgaatttgccgcacacccatggtgcgattcatttcctaatatatgcctgggtttgtatacttattgaatttttttgaaccaactgagttgtaagctcccaaaatcgagcagtgcattactaatagaactaatagaactattataatagaagagaacacattacacagtttaaattaaaattttcattaaacctacctaatttcagccatgattgtccagtgtgcaagtctcaattcatgaccagaatggattgtgtcagccatcacacactcgaacacgaaaatcatcgggagggtcttgaatttttctgcgaagtgagttctataacgttgtaatttgagtggttttctgtctgtgggatgattgaaaatttgttattattgttggatttacgatacaatatatattttttcagaaatgctatagaccatttgctgacgaggccagctacaatcagcacatgagctaccacacgcgagttagcagtttgattgaaactggagaaattgttgtacgtttacaaaagttaatatttgaacaaataactaaagctcacttttttttcagcctcagccagcagatccggaaattttggtaccaacgaatgacgagtttcaaatgctgtttggcgcaaactttggccagcagatgatggaaccacagttgatttgaaattgattattattattgttgcttagatagagtaattcagcttgcgcacttacccatttttgacgccttcgatgacatttctttcaac