Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52B11.3   

sjj_F52B11.3 RNAi JA:F52B11.3
Simmer:F52B11.3
PCR_productsjj_F52B11.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F52B11.3 Source_evidenceePCR1097WS150 Sequence/Annotation Release
Chunk_score Abs_score1055
Max_abs_score1055F52B11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1409502114096204
Overlaps_transcript F52B11.3.2 Source_evidenceePCR1097WS150 Sequence/Annotation Release
F52B11.3.1 Source_evidenceePCR1097WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52B11.31184cttcctgcttcatctacgccgtcggtcgccaggatgctaacatcaaggccaacccatcaatggactattacgagttcaactgtgaatcccaattcggaggaatggctctctgtaccaacgagggaatccgcttcatcgtcaacaccaaggagccatacaccggagccatctacgctgctgagagattctcgacatgctcccaagtcgtcgagaacgctaagcaaatctcgatcactttcccaccaccaactgtttcttccgattgtggaactgttattcgtgacggaaagatggaagctctcgttgttgtttctttggatggagtacttccacatcaagtcaccactgagtgggatcgtttctaccgtgtctcttgtgatgtttctatggataagatggtcaaggaaggatcagttgttgtcaccacaatctatgaggcttcttctcagaacacaacagtcttggatgttgctactccaccaccagtctctgctgaacttcagatccttaaccaacttgaggagccacttcacaaggcctctatcggagatccacttctcttggttatcacttccgagcaagctggaccacacaacatgatggtgacagagtgcactgctactcgtgtcggaggattcggagatactgttccattcactcttatcgagaacggatgcccaaggtacccagctcttgtcggaccagtcgagcaagactttgacaagaaccgtctgaagtctgatcttcgtgccttccgattggatggatcctacgatgtgcaaattgtgtgctcaatcatgttctgtgccggaccaaatggatgcccagtgtcgaactgccttgattcaggaaccaatgagttgttcatgtcccatggaagaaagaagagatccgctgatttagaagctggagagaccgaggagaagctttcggctatcattcgagtattcgcaaagggagaggacgaggaggagatggagatggctaacaacacaatgatgaccaggtaaaaattatttacggtttcagcagttgctctttatgtttcaacatttatttcttataataatcgtaacacttttctaattttcagcatgtccgactccaccgagcttctctgcatcgctgagccattcttcgtgagctcagtcgtctcgctctcagtgctctgctttgctctttca