Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52B5.6   

sjj_F52B5.6 RNAi JA:F52B5.6
Simmer:F52B5.6:Screen_A
Simmer:F52B5.6:Screen_B
PCR_productsjj_F52B5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F52B5.6 Source_evidenceePCR498WS150 Sequence/Annotation Release
Chunk_score Abs_score435
Max_abs_score435F52B5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI83289478329822
Overlaps_transcript F52B5.6.2 Source_evidenceePCR495WS150 Sequence/Annotation Release
F52B5.6.1 Source_evidenceePCR498WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52B5.6876ccgagacttgaagaggtatttgatactacaataaaatctgcttcctttttgaatcaaatctgcacgttgcaatcgaatcgattgcttcccacaaagctcaactacgtttaatgaatatcttcatcataacggtaacgaacaatgaacaacaaatagatttagatgaatccgatcttgttggcaacatcaagagcatcgtagtccgaagccaatcgaacgtaagctttcttctgttggagtggagtaatcagggtgttgacctgtaaatttgaaatattacgtgaactgataattaggaacataccttaacagccttgacgttgtaaagggcatggacggctctcttgatgtgatgcttgttggccttctcgtcaacaatgaagacaagggtgttgtggtcttcgatcttcttcatggagctctcggtggtgtgtggagccttgatgacagcgaagctatcgagcttgtctctggctggagcagacttgcgggcatatctataaaaatctgtattaataatcgatttttattagaatcgtcttaccttggagctctggcagtcacaagggtctttgggcgtctgaagtggactgatgtacgaacgttcttgcgaacgttagtcttgcttcccttgacgacagctttcttggcttggatagcctttcccactttgtttgatgacggagccatgtctgcaagatttaataatgaaagaaaaactgaaaaatgagcaagatcgatgagaaaacaacaaatttaggccaaaaaataagcaaatttcgaaggaaaatgagaaagtacaaatttcgtaggagggtgcagacacggagtaaagaatagcgtcagtgggcaatgattgacgcaaatattgttcag