Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52C6.12   

sjj_F52C6.12 RNAi (5)
PCR_productsjj_F52C6.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F52C6.12 Source_evidenceePCR452WS150 Sequence/Annotation Release
Chunk_score Abs_score368
Max_abs_score368F52C6.12
Specificity_index0.802
Rel_score1
Map_statusUnique_ePCRII19290221930177
M7.1 Chunk_score Abs_score91
Specificity_index0.198
Rel_score0.247
Overlaps_transcript (2)
WB_DNA_textsjj_F52C6.121156tcgaaagatgaatcaacgaaaatttcaagttttaactgtcacaggaggaatcgaaaatgctacttcatcgatggacatgtctgtagagaattcttcaaccttttaacaatagatttaacaaaaaaaaactttattcccaataaactataaaatcttgacgatttggttttgtacctcctcggcggtcatcttttgccatgatggaaccgagcgacgaccgacaatctccgattttaccagccgcaacagcctcgacgacgagcttctcgacgtttcaactgaaaaaaacaattttagtgggaaaatgaagtatttaagatttacagaagatcaaacttactgtactagtcgattatgttaacggtgatgacaatcgtggagtgattttcagactcgttcttgttgccgtgatggaacggagcggcggtatcgttgttcatccggatttggatcacagagcagcgagcagatcgaaagcagaactgaaaattaaaagttataactcgaacaatattgataatatcaacctttcgaaatggtcagagtcggcgaccactgaaaacgcagaatgtcaagaagttcggatggcaaattcgagtggtgaaatcaacctgaaaataacgtaaatatatattgttttccaattttgataaatgcctttggtggtttgaatggatagtctgtcgagaagtgatagtgaggaagaagatacctccctgatagggagactctggtgggcccataatcgtagcttgccaatggtacaaatcatcaccaactgatccagtggagcattgtgcgggtggatcacggccgagatcatggagttcctgaaacgtacataatatttatatcatttaatgttgcaagctcactttctggattcttttgagagccatgttggtgttctgatttgctcctcttttgccatgatagaacggggcggcggcatgggatggacgacaatctccgatgtttcagacggtagcagcctcggatatgtctcgtcgaggagatctgatcttgcatcagctttgcgcgtagtggttgtaggcagaggcatcttccatgtcaccgacggcagcagcttcaacacagtgctcctcgaggctcaactgaaaattgaagaattttactgggaaaatcgagtatttcg