Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52C6.3   

sjj_F52C6.3 RNAi JA:F52C6.3
PF:GL1_6H11
PCR_productsjj_F52C6.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF52C6.3 Source_evidenceePCR594WS150 Sequence/Annotation Release
Overlaps_Gene F52C6.3 (3)
F52C6.2 Chunk_score Abs_score129
Specificity_index0.12
Rel_score0.189
F52C6.4 Chunk_score Abs_score258
Specificity_index0.241
Rel_score0.377
Overlaps_transcriptF52C6.3 Source_evidenceePCR831WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52C6.31094gatttctcccttgtttgcttcttttttcaccgttgtcctcgtttttctgttgcaaaactctcaataatatttaatttataaatttttccagctaaaatcatgctgctctccatcaaaacgtcgactggaaaaaacatcacagtggaagcgccgaaaagtgtgaaaactgaagttcgcgacaaacagggagtcgttttcactgtctcttacggtatttattgtttttttctgggttttgcattaaaaaaatcattttcagacaaaggtaccggaaatcaaatcattgaaatggaggacactgtccaagatgtcaaaattcaagaggctcagcaagcaccgcttcgtgaatcagaagaagtgaccgaagatcccatcagtgtcgaatcatcggaggtcatcggaaatctgaatgtcaaggttgccgagactcagcaagaactgcatcatgaaggaatccgaatttacgttgagaacgctggaagaacatgcacacttgacacttccgcctccgataccatggcaagtgtcaaggctaaaatttgggaaaaactaagaatcctcccaaatacgcaaaaactattattgggtttgtactttaaatattgaaagatatgtctaatttctttaatttttacagaaaactgggacctagatttgtttagcgatcatagcactctttttgacaacagtttcgaaaacggcagtactcttcgtttggaagtttctatagaaaaagaaattgacgtttttgtgaaaacctataccggaaagacaatcaccatttcaatctagaatacggatactgttgagaccttgaagctcaagattcaggataaggaaggtattccaccagatcaacagcgtcttatttatcaaggatcgcagctcgaggatgaccgtactttgattgcctataacatctataatgaggctactctccgtttaattctcagacttcgtggatgaagttctcaatttgaatattgttaatttgttacttgttattttgttactgttctgtttatttttgttgatgaatgttgaaaaagtttagatttttttgaaattaaaaatatggtttttaaacagccggt