Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52C6.3   

sjj_F52C6.3 RNAi (2)
PCR_productsjj_F52C6.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF52C6.3 Source_evidenceePCR594WS150 Sequence/Annotation Release
Overlaps_Gene F52C6.3 (3)
F52C6.2 Chunk_score (3)
F52C6.4 Chunk_score (3)
Overlaps_transcriptF52C6.3 Source_evidenceePCR831WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52C6.31094gatttctcccttgtttgcttcttttttcaccgttgtcctcgtttttctgttgcaaaactctcaataatatttaatttataaatttttccagctaaaatcatgctgctctccatcaaaacgtcgactggaaaaaacatcacagtggaagcgccgaaaagtgtgaaaactgaagttcgcgacaaacagggagtcgttttcactgtctcttacggtatttattgtttttttctgggttttgcattaaaaaaatcattttcagacaaaggtaccggaaatcaaatcattgaaatggaggacactgtccaagatgtcaaaattcaagaggctcagcaagcaccgcttcgtgaatcagaagaagtgaccgaagatcccatcagtgtcgaatcatcggaggtcatcggaaatctgaatgtcaaggttgccgagactcagcaagaactgcatcatgaaggaatccgaatttacgttgagaacgctggaagaacatgcacacttgacacttccgcctccgataccatggcaagtgtcaaggctaaaatttgggaaaaactaagaatcctcccaaatacgcaaaaactattattgggtttgtactttaaatattgaaagatatgtctaatttctttaatttttacagaaaactgggacctagatttgtttagcgatcatagcactctttttgacaacagtttcgaaaacggcagtactcttcgtttggaagtttctatagaaaaagaaattgacgtttttgtgaaaacctataccggaaagacaatcaccatttcaatctagaatacggatactgttgagaccttgaagctcaagattcaggataaggaaggtattccaccagatcaacagcgtcttatttatcaaggatcgcagctcgaggatgaccgtactttgattgcctataacatctataatgaggctactctccgtttaattctcagacttcgtggatgaagttctcaatttgaatattgttaatttgttacttgttattttgttactgttctgtttatttttgttgatgaatgttgaaaaagtttagatttttttgaaattaaaaatatggtttttaaacagccggt