Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52C6.4   

sjj_F52C6.4RNAiJA:F52C6.4
PCR_productsjj_F52C6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF52C6.4 Source_evidenceePCR877WS150 Sequence/Annotation Release
Overlaps_Gene F52C6.4 Source_evidenceePCR877WS150 Sequence/Annotation Release
Chunk_score Abs_score730
Max_abs_score730F52C6.4
Specificity_index0.587
Rel_score1
Map_statusUnique_ePCRII19228701924350
F52C6.3 Chunk_score Abs_score513
Specificity_index0.413
Rel_score0.703
Overlaps_transcriptF52C6.4 Source_evidenceePCR877WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52C6.41481gtgcattgtgtgcaatgtgaactttttcgcttaccgtagtttggaaatttttgttcttcgatttattgattttttcgaaactcttgcccatatttacttgttttttctcattttttatcgaaatttaaatgaaacaaattagtttaagtgctatattttttttattcaacagaataagttcaaaacttcccgaagatcaaatttctgtggattgttactcttttttcactgttttttgttgcaatactctcaataaattcaacttttccagctaaaaccatgctgctctccgtcaaaacgtcgactggaaaaaccatcacagtggaggcgccgaaaaatgtgaaaactgaagttcgcgacaaacagggagtcgttttcacagtctcttacggtatttatcgattttttttttggtttttatttcaatatatgtttattttttcaggagaagtaaccggagatccaatcactgttgaagcatcggacgccatcaaggatcttaatttcaaggttgccgaggctcagcgaaaaccgcatcgtgaaggaatgcgaatttacgttaaaacttgtgaaaaaacgatcactcttgacactgctgcctccgataccattgcaagtgttaaggctaaaatctaggaaaaacgaggttttccatcaaatctgcagaaactatatttgggttagtactttgaaactgatagcttgtctaatttctttagtttttacagaaccttccaacattgttttgtgcaaggatcaacgtactatttctgactacaacatcaaaaacggcagtactctccgtttggaagttcctgtaaaagaaaaactgacggtttctgtgaaaaccttattcggaaagacgattcctatttcaatcaagaatacggatactgttgagacattgaagttcaaggttcagaataaacacggtgttccaccagatcagcagcgtctcattttcggtcgggcacagctcgagaatgaccgtgctctgttcgcctataacattcgtgatgaggatattatccatttagtctccagacatcggttgtgaagttctcaatttgattgctcttaatctgttgttttgttacttttttgttttttattgttgataaatgttgaaggttttttttttaatttttaaattaaaaacactgtctcaaaatattacaggtaccatatttatgatatatgagggtttttttccagtaaattcttctgtgttctgaatttccgacttaaacattttatttcgatggttcagaaaattggtttttcaggtttttggatacttcaggctgatattttgaaatactcgaatttaattcaatttagcattattcaacccgctagaatttctgttggcacatgtttcttcaattagaatttctattatttaaaaaaccacaaagaatttaataaaaaatcagcgaaactacggtagacgaggaagtaggcagttgcacacgatacac