Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52E4.7   

sjj_F52E4.7 RNAi JA:F52E4.7
Simmer:F52E4.7
PCR_productsjj_F52E4.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF52E4.7 Source_evidenceePCR822WS150 Sequence/Annotation Release
Overlaps_Gene F52E4.7 Source_evidenceePCR822WS150 Sequence/Annotation Release
Chunk_score Abs_score718
Max_abs_score718F52E4.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX30968553098046
Overlaps_transcriptF52E4.7 Source_evidenceePCR822WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52E4.71192cacaaagtttgcaaagcgaaaaattgatgggagaattccgattctagtctttttagcaatgcgaacttccgagtactgggaacattccatttgctggaagagaagattattgcaattacagtacatataaatggaactcacaataaatgcatcaaactggcgttttatcagaacaactaaacttccaaatgtgatcgaaaaataggagcttgggtcttgtggtagaagcactttcttcgacatgattacaaacaaaaggagaacattgctaaaatgtgtaggaatttaaaataatatgtacgtgtaccttttctcacctaggattgtgcctacaaaccgcccgacagaaactatcaagatgaatattgagcgagtcaaacaagttgcccataacgtgtctcacttgctcgttcatatgtttctccatactacgtcctccgagacttgagctatcaccgcttccagttgaagtcgtatcgaactgagccaacagctccgagttgatgtggaagaagcggacaacgaacttttgctctgcgtcaatcacagcgctcagttctgccagcaccgtttcgatgagttgcggtaagacttcagtatcaatttcactggaggtgctcaggaaactctggttgtcagaacgaagtgaaatgtttgcagattcatttgcttctgaaatcagatgattattttttgctgcaaatattagcaaacatacttgacttcttttcagaactgttagcttttggaactttgttgatcagtgtctcaaagaaattgtcaaatagacgtttgtaaagtagattcgtgctgtcgatatacttttgcaagactaaattgcaagcctttggacggttcgttttcagccagttgataagatcagagagtggagaaagggcgcgaaagcgttgagactgttttggaatacacagttcatgccactcatgatccaaagataagtcgttctgaaaaaaaaacacgcgttgaaaatgattttatacagtgcgcgcgcttgctacaggattcttctaaaatttataatagatgtattgaaaaaactccacattttaacgtgaatctattgtgaaattatggtatgtgatgtaaaaaaagcttcgcatgcgctgtaaaatatctgaaattcgagaattttggttgaaattttcaaaaaattcagagggtcctttagcga