Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52F12.1   

sjj_F52F12.1RNAiJA:F52F12.1
PCR_productsjj_F52F12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F52F12.1a Source_evidenceePCR826WS150 Sequence/Annotation Release
F52F12.1b Source_evidenceePCR826WS150 Sequence/Annotation Release
Overlaps_Gene F52F12.1 Source_evidenceePCR826WS150 Sequence/Annotation Release
Chunk_score Abs_score721
Max_abs_score721F52F12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI98885089889675
Overlaps_transcript F52F12.1a Source_evidenceePCR826WS150 Sequence/Annotation Release
F52F12.1b Source_evidenceePCR826WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52F12.11168gattctcgtttcttggctgcttgtgtgaacattccactgtctggttctggctttttacctgaaatattatttcaattattaatgatttgtaaacagcttgcaagagacctataagcatatgcctcgtcctggaacattataagacagtccaagtgatacctttctttaccacgaagtaagcgttagtattctaagacaccgtatctcaaagtctttaactcaccaaaattctctgcatcctcaattgtcattggcagtggtgctccaagagtttcgggtaggaaaaatgtcaaaataccggcagacaaagccatcaggcccatgataagtagaggcaatatctttactattttcccctgaaaaatcgtttttccaatatttattttgtggttcaaaaagttttataaacttatttataaaaaaagaaaccctaccaaattaacaatatgcggagccaacaagagcccagaaccggcaaccatgctactcattcccattccaattgctctaacaacagttggataaagctctccagcaaatatatagataacagcgaatccggatccaactccaaattttcctataaacgaagcactggccacaagccatggataaccatctggcataaacattgcagaaacacatccaataccacatacaatcattgttgctgcaagtgtccaacgacgacccgcacattgaagtagaggccaaacaacgaaatatccaggtaattcaactgctccatttattataaaactccaataatcatcaactggaagatttgaaacattcaaagttaatccattgtaaataattgcattcattaccctggaaatattacttttttataggcattttataaaaatatgaaaatcttaccatatataggtcacaatcaaagtttttcttcttaaattaggagttttaaaaagatctgtcacattgtgacttctcttcgtttctttttcttctgcagcattttgatggtttttcatctgaaatttgtttttttggtaaaacatataattgattaaaaacctcacactatccactaattcatcaacatcaacatttgactttccattcatctttgcaattttcttaagctgtttcttagcgtcagcccattttccgactgaaactgaccatcttggagattctggga