Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52F12.5   

sjj_F52F12.5RNAiJA:F52F12.5
PCR_productsjj_F52F12.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF52F12.5 Source_evidenceePCR441WS150 Sequence/Annotation Release
Overlaps_Gene F52F12.5 Source_evidenceePCR441WS150 Sequence/Annotation Release
Chunk_score Abs_score399
Max_abs_score399F52F12.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI99208189921814
Overlaps_transcriptF52F12.5 Source_evidenceePCR441WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52F12.5997aatctggaaaagattggggaatatcattagattttatagaagataatgttttttttttataaaagtcgatagtttttagattaaaactttccaatttttctatatttactacccaattaaaataacaattttgaggtaaaaatacaatgtaaaatttgaagaatcgattgttgaatattgcggtagaacaagtagcagagaactactgtctatacaaaggattgctctctgttcagcaaagatcgcgtcgagacctcgtggcgaacttgtgcccaaaaaattgatttttgcaattagtgaactacagaagactctacataagaacggatacacaatgtaagtcaattttctttaaatcatcctataaaatctcaaaaacaaaattgaacagattaaatttaaacatcttcattcaccaaaagagagatgctattgaacgatattacacaagttgttagctctttataaaagagaatctatagaataatacaacagcccgtactctttttcttttgttctccatcaactgatccttttcctggtgtactggcaattggaggaactcgagatgaagctggtttgacctttgatgcaactgtttctactttcacggaaccttctttcttgatcttttcattcgattcttcggcactgttctttttcggtttttgactttccggcgcttttggtttaacctccttctcatcctcggtcattgattgcgttttttgagtcatcaactgaaagttagtttatgtttaaacgtgttattttggtattcctcttttttccaggcaagctgattaaaatgtaaacttacaaatttcttctgagccaaatcctcttctttacttgtctctttactttccttactcttactctctgtactactcttcttctcatttccttttgatttctttttctctttcactggatcatcatcttcactcagactcaattcaacattgtcataaccttttctttgcactacagctgt