Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52F12.6   

sjj_F52F12.6RNAiJA:F52F12.6
PCR_productsjj_F52F12.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF52F12.6 Source_evidenceePCR933WS150 Sequence/Annotation Release
Overlaps_Gene F52F12.6 Source_evidenceePCR933WS150 Sequence/Annotation Release
Chunk_score Abs_score814
Max_abs_score814F52F12.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI99051319907639
Overlaps_transcriptF52F12.6 Source_evidenceePCR933WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52F12.62509gagagaattgttggaagagagcatccatcatttgactgaaaattcaattttatagaaactgtttattgagaatgaaatagaataccttgatggaatgagtcctgcttgtgctgcagccaacaattgctgagctgacaatccagctggaagtccagaaagtgtcaagtcaagtggacattcatcagaaatactgattcccttaattggagttttcgtgcgttgtggtgttgtcttaattcccttccgtgcaagcttttcctgatgggcaattggacaaccagagagactacggtgagatgttctatttccattgacatgtccctttccagagcatccggctgtggtgcatcggagcacggtgtcttgtcggagagcaagcactgcaaacgggaaaagtaagtgagtgagtgggaaaagtcatcaatctttggctcttgctactgctacaagtattggcttcaaagtaagtatgaaatgcatgagagctcatttatcttaagctctttttaccagattaatgagctagtttacttgttgctccaagttcacagccagctaagatttatgtttagtttcaatttaaacttactttggataacagtcttgtctggtctacgtggacatccggacaaacttctgtgatgagtgtagagtcctgtctgatgtcctgatccatcacatccaggtgttggacaagccagtttgccttctgaaagttgggacttagtaccgctccaaatggaatttcatgtgattcggtgcgagtggagtggtaagtgaggggattagtttattttgtggttagtgcactcattttatccctcccaaatggattattattttttgatattcttcgaaagaaaactcagaatgggggaattagtggttagtaagttggggttagagattgattttcaactgaaatatcttcagaggattactgtagggtcccaactttctgttcaaaaagtccttaccacgtctgatgctccatgagtaaccagtaccaggtgatggaattgatccgtttggagtaaatgcaactgttggagttgtagagattgaaagttcatcactgatatttgtatgtgtaattggagacataactcgagattctgatccagatgagtgtggtgggcttgaagcagttaatggagtctttggagtatccgacgatgtcatcattgggctctgaaaatcgtattttttggtaaaaaagatatgaaacgaagaaaaacaataatagtaatccatcaaagttggcaagtctcactctttactactactactcctagtaagaacaatcggtgaggcggcagtgtcattggtcacgcaatgtcatccgttgggttctaaggtgttttgtgtctgttttgacatataattaaagttggaagcccttgcgtgaccagcaacttgttatttcaagtcattgctaccaactaggtggtccgaggagttgtaagaaatttgatctaccgtactcgctttaacaattgaatttaatagagtttccaaaagttccgtgaattttcctgagaactttcctaaatcttatagaaaattccagaagttttcctaattttctaaaatctccagaagatttttgaacctcctagaacttttcaaacgtttctccagcttttctttctgaaacctttcgaaacagtttcgacttttcaaagttgctcggttcttccaagaccttccagatgatttttaaaaatttttaaaaattttccggaacttcccaaaatttcctcgaagacatgaccctaattttcgttaagctaggcattgcaaaactaccagtttcccttgaaacttctcacttaaattttcaaaattttgaaataatttcccaagttgagctgccattcccaatttcaatatgtgtcaatgtgagttcataaatatgcaacaagtcacttttctctaccgtgtgccccccattcccacttcacttcttttcactcaaaatgcaaatttctttggcttctcacctttgacgacgacgtctcctctgctgtcacgacaccaccatccaaaactgagtcgacatcggaaggtgatgtgtcagagtgtgtggcgctcatcatatttcctgatgtaaaaatttcaagctgtttttggaaggatggagccataaattgcgagaagaggaacgacggaactccttcgaggccacttggaactgatgaggtgacgacatctgcggaggtggcggtctgaaagtgaatggaatgaatgaagatgttatctcaaaggatctcagacagatgtacaggcacatgttcttcttcggaagcataaaaaagttgttaggtaatagttcggaacgatggaacaggtgctctctctaggccctgtcagctgtcttttgcgtccttttaagaccatccaaggacacatcatatatttaattgccgattcgatttcaaaaccgaacactaaattttactaacctgttcagttggtttctgtgcattgtttgttgtcgtgtcacaag