Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53B6.4   

sjj_F53B6.4RNAiJA:F53B6.4
PCR_productsjj_F53B6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53B6.4 Source_evidenceePCR883WS150 Sequence/Annotation Release
Overlaps_Gene F53B6.4 Source_evidenceePCR883WS150 Sequence/Annotation Release
Chunk_score Abs_score799
Max_abs_score799F53B6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI89474108948566
Overlaps_transcriptF53B6.4 Source_evidenceePCR883WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53B6.41157accaatgggacaaccatcatctcacgatgctccgcttggttagcaaatgcctcatgaggattagtagagccgttggcctgaaaattagtttttgggaagttcatgttataccaaaaacttacattggcagtcaagagcacaagtttgtcagttttctgctctccattcaatctcaacacatcaatcttaacggaagaacgtggctcagcaaatccataaaccggattgacacggtaaagggagttatccgagcacttgatcttataagctttacgttcatttgaagtattcttcaattcaatttgattgactccgccaagtgtctggtattgaagtttagcaggagccacattcatttccttggagtgcttgatcgaattgacttcttcagcaaggctatgcccaacttggcttccagttgtttgttgctgacaaataattattgaaaatgcacattttgataaatgtcttaccgtttttggaataagagcaactttgccgctctttcccgatttctccattttcttctgggcatccgaatcaagtcgacgattcttacggctcttcgaactctttgagctcttacgagaagatttcgatgagttagattgcttatcagaaacaccagtagcagcggaaacagttgaaacttgagaaccagaggtggtagcagtcttgactttcttcgatttcgaagactttgatgatttccctccacgcttgctgcttccctttccagattttccagacgttcccttcttactagacttcgacgatctcttggagtgcttagctttcgatgaacggcgagatttcccactcttcgacgctccacgagtagatttcgacgatttggcagatttgctgctcttgttcttattcttgtttttagcatggacctggaaaaagttataggtttgtttgtatgaacgccgaaatctatatggagacttcagaaactacaaatgcatcatccattaattttccagaaagattcaaagtttgagcaaccaatagttcccgataatggtgggatttggcaacttcggcaatcgctagttgccacacagccccactacataccgtcttacgattcttggcacaaaaagcgatggcggcaaccatcggcaacgacgtagtcacaattgcagtcagcg