Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53B7.5   

sjj_F53B7.5RNAiJA:F53B7.5
PCR_productsjj_F53B7.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53B7.5 Source_evidenceePCR1096WS150 Sequence/Annotation Release
Overlaps_Gene F53B7.5 Source_evidenceePCR1096WS150 Sequence/Annotation Release
Chunk_score Abs_score1033
Max_abs_score1033F53B7.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1097966910980860
Overlaps_transcriptF53B7.5 Source_evidenceePCR1096WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53B7.51192agcaggtgttgttataggtggaagtgttgtgattggaaccacggcagtagctgaaaataatatgttagtatctagatttgaatattgagcttacttgatgccaagcagctaacagttgaaatctgtttcccttcataaacatactctccattcgtacaaaccaaatccattgccaactctcctactcctgacataacttctccatttggattgtagtacaaatacgctacatcattttcactcattgttgcttgacaagatatcgaaactcgattacaaccgttctgcttataatgccaaagaactaacatcccattgtaagtaccggcggcattttttgccaagggttcaagtgccacacaattattacaaactgaaggaagagttgttgtggttgattcaagttcttctacagtggtttcatcaattggcgaacccgttgctggtccacgagttagtgttccacctccaggagtagatggcatgctatcaactgttgtcatatcattttgtgtcgtgctcataattccacttggtgtcgtgacttcttccggtggttccgcttctggtgtggtctttggttcggtaaccggtttgaatgacgagtctttggtcggtggccctccatcggtcgatggtagttcgtgaagggtagatgcaaccaatggagttgttgtggctacttcaggcattatacaagaaatattgttgacaatgctgttagttgttgtatccagccattttgaatttttggtgcatgtaaatgttctgtttactgtcgagccactgtccaagattcctttgttgttatacatcaactcaacaagtgtacctccctgaaacaataaaatttaaaaaacataggataaaaacagagagaaaactcacattgattggtaagcaatgagcatcaacggacaaacatttatcaagagtatgatctagataagtgacaccttctggatgaatcgattgactgaccactaaatttgtacagttcatgcagggattgttgggatctattccaggaattgtagttggtcgtttagtagtggtagttggatttgcataaacacatcccaaagatgtaacagaagctgccaaaggactcgtcgaactgagaaggacccattttttgtcacggcaagcaagattagcactcaatggagctgatagatagcttgtgtcgcct