Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53B8.1   

sjj_F53B8.1 RNAi JA:F53B8.1
Simmer:F53B8.1:Screen_A
Simmer:F53B8.1:Screen_B
PCR_productsjj_F53B8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53B8.1 Source_evidenceePCR764WS150 Sequence/Annotation Release
Overlaps_Gene F53B8.1 Source_evidenceePCR764WS150 Sequence/Annotation Release
Chunk_score Abs_score722
Max_abs_score722F53B8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1178264011783665
Overlaps_transcriptF53B8.1 Source_evidenceePCR764WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53B8.11026attcagggatcttcagggctttacaaaactctacaaacttcaaaaaaagtttcaaaaatctcgcaaatttgagagactgtttggagtacaacatcctacacaaaattggccgaaaatttcgtaccgaattttctctattagtattgcacccgactacttaactttgaaacgttatatctggtttattttgaagatatcaatatattattaactacgaaatgatagaaaaagaactatcaaatagtttattagttgacaatttttaaataggacaaacgataactgagatataagatgtcaaagttgagcaatgaggtgcactactaatagaggaaatacggcaatttagccagaggaaagttttaaaaaagtgtgcacgacgaaaaaaaaaactcacgtcgtctctcttgccagaccgagatctttctcgttctccacgtgtcttcttcactcgttgcacctttcgctcaaagtgctcgcgggtctcgtagctcgagctctccgagaatccaccgtgtgcctgctgagcattggacaagtgctgattgtgtgcatgatgaatgatttgtccaccaccatttccaacatgtccattcccgccggcggctccatttctgctcgagtactcctcatagtagctagagtttccaccacctccggctccggctcctccaccaccactgatcgcctgctggcttcctccttgagccgaggctctagagctctcggattttcgctccgcttttttcgaataacttcgcaccactttaagcattgtcagagtggttgcaagtccgaatagtaataatgctgttgtggctagacacgatgtcgcatgccaaacgtacgaatcgcaatggtcgcacgcgtgggaatttgaagaagaagaagaagaagaagaagaataggaacttgacgacgaaggtgttgtaaaagaagaagatgaaaaagaaaacgaagaatactcccgatgttgggcgtgttgttgttgtggtggttgtgggggtgatggtgatgatcggagaa