Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53F10.2   

sjj_F53F10.2RNAiJA:F53F10.2
PCR_productsjj_F53F10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F53F10.2 Source_evidenceePCR1086WS150 Sequence/Annotation Release
Chunk_score Abs_score1023
Max_abs_score1023F53F10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI38324633833659
Overlaps_transcript (7)
WB_DNA_textsjj_F53F10.21197tcgtgtgatgcttccaagagttcgtcccaactatgcagtcgcttgtaatgctgatccagtgttggctagagttctctcgaacaacatcgatgtcaactttgaagtgtcgaatactgcagaactcgagttagtcagcatgaatgtcgaaccatcgagagcagttttctgctcacaactgatgactcgtaaagctatcaaaaatgctgttttggctggatgctccacttttgttgtagaaagcgagaaacaagttaccgatgtgatgaatgcatcaccagaagctgaaatcatcctagctgtctgtcttccatactcgactggagaagttccattcggatgctcagttgatgagattgaggagattctagatatggctcatcttcttggtgcaaatgttaccggaatctagtaagttaaactttttttaaaatttccaaatcatatcttaacaaaagtacatattttcagtctcgaacttggacttcgtgccaccctggaggactacatcacatcagttcacgatgctcgctcgatcttcgaaactgctgatcaaaagttcctgacactccgtcgtgtctgctttgggaatctctctgttccaactggagccgatggagctgtgaataatgaattcatgtcattttgcaactctctcaacaatgtcattgatgacctatttgaatctaatattgatttctctgcaagcatcggacgtttccttgtgacaaatgcattcacattgtgcacaaatgttattggaaaacgtgcaatggacgccaaatttattacaaacgatgatttcgatgatggagttggatttgtatatcaaaccaatgatggtgtatatggatcatttggatgcaagcaaatggatattaaaccattgtgtaaaccattggatgttgagaatgactctgaagagcaactacatttcggaacgattctcggcccaactttggatggaaccgatgttgctcaaagactcatgaaaagccgtcaattgcgtgtcggcgagtggctcgtttgggaacaaatgggcgctttcacaattcctgttgacagtgagcattcggtgccgcctgtgtattactattctggaaaagaatgctggtgagaacttttgaaccttgagattttgaaattaaatttgaattattccaggcaaaaactaatccacaaagatgaacaacgccgttc