Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53F10.4   

sjj_F53F10.4 RNAi JA:F53F10.4
Simmer:F53F10.4:Repeat_b
Simmer:F53F10.4:Screen_A
Simmer:F53F10.4:Screen_B
PCR_productsjj_F53F10.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F53F10.4 Source_evidenceePCR632WS150 Sequence/Annotation Release
Chunk_score Abs_score569
Max_abs_score569F53F10.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI38249703826049
Overlaps_transcript F53F10.4.2 Source_evidenceePCR628WS150 Sequence/Annotation Release
F53F10.4.1 Source_evidenceePCR632WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53F10.41080tttcaagtacattatcatcggggatactggagtaggaaaatcctgcttgctccttcagtttaccgacaaacgtttccagccagttcatgatttgacgattggtgcgatttttaaattttattcaagtttttttttcaaaataattattttccaggcgtcgaattcggagcccgtatggtgacaattgacggaaagcagatcaaacttcaaatttgggacacagccggacaagaatcattccgctccatcactcgttcctattatcgtggagccgccggagctcttctcgtctacgacattacacgacgcgacacattcaatcatttgacatcttggcttgaggatgccaggcagcacagtaattccaatatggttattatgttgattggaaataagaggtaacatttttttaaaatatagattattggtttttaatatatcgaaaaataggttaactactgttgaaattcaacgatcgatccttgaattttgaaaataaaaattttcgccggttttccactgcattctcattcgaaaaaaaagaacaaaactaaaaaaatagtaaaatcgaaacctttttgattaaaagctgtgaaaaaaaggagaaaaaacagtgccactgggttgcgaattcacgctccgcatctctttctgtgtgaagtgtcaagttgccttttgcaaaattcaaggatcgattgttcaaaaatttctctacaaaatcgaacaatttatagaaatttggttttccaaataaacacatttttattcaaaaaaataaaataaatgttttcagtgacctggaagcccgtcgcgaagtgaaacgtgaagagggagaagcattcgcacgagagcacggactcgtattcatggagacatctgccaagacggctgccaacgtggaagaggcgttcatcgacactgccaaagagatctaccgtaagattcaagaaggcgtgttcgacattaacaatgaggcaaacggaatcaagttgggaccacagcactctccaagctcaccaaattctccaggtggaaatgcgacgggaggattgggcggtggatctggatgctgttaatttt