Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53F10.5   

sjj_F53F10.5 RNAi JA:F53F10.5
Simmer:F53F10.5:Screen_A
Simmer:F53F10.5:Screen_B
PCR_productsjj_F53F10.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F53F10.5 Source_evidenceePCR949WS150 Sequence/Annotation Release
Chunk_score Abs_score886
Max_abs_score886F53F10.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI38180813819147
Overlaps_transcript F53F10.5.2 Source_evidenceePCR949WS150 Sequence/Annotation Release
F53F10.5.1 Source_evidenceePCR949WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53F10.51067atgtttggaggatctgcaccaaaaccgtcgattttcggaggaaccgctgctaccacaacagcctcatctggattttctttcggtaattcgagcacatcaacagcgaacacaggtatcgatcgatgaaaaattcaactaatttatttttttcgtttttaggcggaaacacgaatactaccggaggtttttcttttggatccgcacagccgagcactggaagtactggacttttcggaaacagcacagctactggtaggtttttggtttaataaacttgtaaaatacgctcccgtattcaaaaagtataattttaaatttttcaggctcaatgtttggaggctcctctgctgcagctccagccccagcgtctgctggaatctttggaaattctggtgccgcggcgccagctcccgcttcaacgagcatttttggaagttctgcaaattcagcagcacctgctacagtaacgtttggcgcaagcgcaccatcagctggtgctggcatgttcggagctaataaaccagctgctccaactggcggcttgttcggatcatccacaagtaccgcaacaactgcaccaactggcgggcttttcggtagctcaactgctgcgccatcaagtggattattcggatccacggccgctccagcagcaccaggaggactatttggaagcacttccacctctacagcggctccatccggcggcttattcggatcttcagctgctccaacttccacagccccagctccttctggtggtttgttcggggctgcaccagctactagcaatgctgctccaacctctggattattcggaaattcagcacctgctgcgacagcttcatctggtggactattcggcgcagctccaaagcctgcagctccatcgggaggtctttttggttctaccgctcctgcaaccaccgctgcaactacaactgccacatcaggattgttcggagcaccaacatctgctccttcgtccgctccagccactggtggtcttttcggagcctctactgctcccgccgctgctactggaggtcttttcagcattggtgctg