Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53G12.10   

sjj_F53G12.10 RNAi JA:F53G12.10
Simmer:F53G12.10:Screen_A
Simmer:F53G12.10:Screen_B
PCR_productsjj_F53G12.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F53G12.10 Source_evidenceePCR783WS150 Sequence/Annotation Release
Chunk_score Abs_score678
Max_abs_score678F53G12.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI110627112256
Overlaps_transcript F53G12.10.2 Source_evidenceePCR752WS150 Sequence/Annotation Release
F53G12.10.1 Source_evidenceePCR783WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53G12.101630tgcgtgtgaaacccataaaatcgaacgtaaaacaggtcaggcgcaccggcgcagccacgtcggtctgagggtacgcgacgctagccgcagcgcaagcctcctcgggtctcggcacgacaactaccgtacccctttcgcagcggcgcaacggaatctcaattttacatttttttctttttggcctaacgaatttttccgttttttcagagcatttttcattgattttcttaaattttcatcagaataaattttagaactaatttcccgtaattctgatacgcgttttttatagttttcgtgaagaaaatgctgaacattcgaaaaatactgaaataatttagttttgaaaacttgctcctctgtttcaatatcttataattttcttttctgattaatattttgattttccaggtaatcaatcgcctataatggctccaacgtaagttttctttataaatttatattagattgaaatttacttttaggcctgactttcaaatacttcaattttgatattaattcttggtttttcagaaagaaagtgccacaggttccagaaactgtgctcaagcgcagaaagcagagagccgatgcccgcaccaaggctgctcaacacaaggtgaccgtcgccgctgtaagtttatttaactgtcagaaaacagaaaatgctcttcaaaagcactggttttaggatccactattatccaagccagccgtcaaaactgagctataagaattatcttgtttttgggtgaggtgtattcaattcagaatgcgtctcaataacacgatgacaattcgaaattttaaagtttaaattttcttttaggtgtttgaaaattaatttgaactaatcctgcattaaaaataaaattttttacagaagaacaaggagaagaagacccaatacttcaagcgtgctgagaaatacgtccaggagtacagaaacgcccaaaaggaaggactcagactcaagcgcgaggctgaggccaagggagacttctacgttccagctgagcacaaggtcgccttcgtcgtcagaattcgcggtatcaaccagcttcatccaaagccaagaaaggtgaaattgtgttaatgagttttttaataaccattctttgttttcaggctctccagatcctccgtcttcgtcagatcaacaacggagtgttcgtcaagctgaacaaggctactcttccacttctccgtatcatcgagccatacgtagcttggggttatccaaacaacaagaccatccacgatctcctctacaagcgcggatacgccaaggttgacggaaaccgtgtcccaatcaccgacaacaccatcgtcgagcagagcctcggtaatttgaaaacttatgctttttaattcttatttaattgttttcaggaaagttcaacatcatctgtcttgaggatttggcccacgagatcgccaccgtcggaccacacttcaaggaggccaccaacttcttgtggcccttcaagctcaacaacccaactggaggatggaccaagaagaccaaccacttcgttgaaggaggagacttcggaaacagagaagatcaaatcaacaaccttctccgaaaaatggtctaacttgtttgttgttcataccttccttccgg