Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53G12.3   

sjj_F53G12.3 RNAi JA:F53G12.3
Simmer:F53G12.3:Screen_A
Simmer:F53G12.3:Screen_B
PCR_productsjj_F53G12.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53G12.3 Source_evidenceePCR954WS150 Sequence/Annotation Release
Overlaps_Gene F53G12.3 Source_evidenceePCR954WS150 Sequence/Annotation Release
Chunk_score Abs_score830
Max_abs_score830F53G12.3
Specificity_index0.638
Rel_score1
Map_statusUnique_ePCRI138837140015
F56C11.1 Chunk_score Abs_score471
Specificity_index0.362
Rel_score0.567
Overlaps_transcriptF53G12.3 Source_evidenceePCR954WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53G12.31179gactcgcgtgtgaatgagaatcctggtcttctttcatttggtctgatcctcttccgttggcataactacaatgcaaatcaaatctatcgagaacatcctgactggacagacgagcaaatcttccaggcagcacgtcgtttggtgattgcatctatgcagaagattattgcatatgactttgttccaggacttctaggttactcaactatcatttaatagcttaaactcagtgtttcttttaaggtgaagacgttcgtttgtcaaactacaccaaatacatgccacatgttccacctggaatctcgcatgcttttggagcagccgccttcaggttccctcactcaattgtgccaccagcaatgcttctgagaaaacgaggaaataaatgtgaattccggacggaagttggtggatatcctgcattgagattgtgccagaattggtggaatgcacaggatattgtgaaggagtacagtgtggatgagattattcttggttagttcatacttgagtggttatataataaagattgtaatttcaggaatggcaagccagatagctgaacgagatgataacatagtagtcgaagatcttcgtgattacatcttcggaccaatgcatttctctcgtttggatgttgttgcttcatcaataatgagaggaagggacaatggagtaccaccgtataatgaattgagaagaacattcggacttgcaccaaagacatgggagacaatgaatgaagatttctacaagaagcatactgcaaaagtggaaaagttgaaagagttgtatggaggcaatattttatatctggatgcttatgttggagggtaagcgttttttataaattaagttagagatcctccaatataccctcataacatattgtatcagtttacttcatcaataattcagcttgaaccatttagaatgctggaaggaggtgaaaatgggcctggagagatgttcaaagaaatcataaaggatcagttcacccgtattcgagatggagatcgattctggtttgagaataaactaaatagattattcactgatgaagaagttcaaatgattcatagtattacacttcgtgatattatcaaagcaacaaccgatatcgatgagacgatgcttcagaaggatgtgagtttattgtaaacacccgttggtgatgat