Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53G12.4   

sjj_F53G12.4RNAiJA:F53G12.4
PCR_productsjj_F53G12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53G12.4 Source_evidenceePCR909WS150 Sequence/Annotation Release
Overlaps_Gene F53G12.4 Source_evidenceePCR909WS150 Sequence/Annotation Release
Chunk_score Abs_score867
Max_abs_score867F53G12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI135550136894
Overlaps_transcriptF53G12.4 Source_evidenceePCR909WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53G12.41345acgtgtcacccatagcatgattgccgattggctcgagcagaatggatatccaatatcatctcaagtcttgaaaacagaaatgtctggaaactacatggagagtgcagaaaaacacgtggaaaatggggaaaaaatcgataatctattgcgaagtcagctgaaaatcgatattcgcgatggcaccggtgacgattttgaacgaaaatcgataaaatcgattggcgccggccgcccgtttgcaaaaattaatatggtcgataaacagcgagcaccgttgaaaattacaccgcttagtgatgaggaatttcgaaaaacgatgcggaaacggatggaaatggagagggaacgagtgagttgcgttaaataatttttttttgaaatatttaacaaaagtcgacaaggcgattttttaaaatcgatgtttcgcgacttttattcaaaagaaaaatttcaatgccctaaatcactcaaatgatgattaaaaaagtatttgcgcgcgcgcgtaaaatttagtgccagcgtatgacactatgtggtgcaaacttcactccgggtccgacactttttggattttgcgcatcgctataaagatttcagatcgcggcgtgagagcggcgtttgcggcgccgacatgagagtcctactttcctacttttcttggcaaaaaaatcgatcgatttttcagctcgcacgtctatccaaccaggcagaagacgattccgacgattcatcgtcctcctccgactcttccacgtcatccgcgtcgtcatcttccgaggagaagttgactttttcggatatcttggggaaacccacagcagctggcgcggagaaaatgatcgaactaagccaaattcccaacgcatggggtccgtcaaaatccgcgttagtcactgatgacgtggcaagcacttctgacccacttccggcgattttcaacgcacatcttccgccgctctccatgggacgaccaccgctgacaaaaagcgcgaaaagtcgggaaatcgacgccattttcggctcggataacgtggattatgatttagaggatttcgagcaggatggcgtggcgaagaaaaagtctatactgcctatggagaaaaagaaggaggaagcgaaaccaaaggaacaggagctagtggagccgttggtcttgtcagaaggtaactttgaacttgcaccatgcaaaaatttcgaaaaattatgcacgtggtcactggctgtccttttgcataagcttgaagcaaacgcgcctcattgagaattcacgtttgcgccaactctcgctatccattgggcgtgagagacgcagatactacttttttctctgaacgtgaaaaacgca