Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53G12.6   

sjj_F53G12.6RNAiJA:F53G12.6
PCR_productsjj_F53G12.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53G12.6 Source_evidenceePCR871WS150 Sequence/Annotation Release
Overlaps_Gene F53G12.6 Source_evidenceePCR871WS150 Sequence/Annotation Release
Chunk_score Abs_score787
Max_abs_score787F53G12.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI119453120651
Overlaps_transcriptF53G12.6 Source_evidenceePCR871WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53G12.61199gaacggcagtagcctctcacccctgatttgaacatggtgcattgcatcaccgctcctcgacttggaaagtttatatcggtagatatttgcagcagatgtaatttactgatattttcagaaaaagctctactggaccaaaaagtacgccttcaaatccatctgtgagcttattgcctatcacaagcgaaatcacaagccgatttatgagggcatgacgttgatctgtggcctggcacgacatggatggcagctgaacaacgagcaggtcacattgaataagaagttgggagagggacagtttggagaagtgcacaaaggatcgctgaagacatctgtatttgcagccccggtcactgttgccgtgaagaccttgcaccagaaccatctatccgccaatgagaagatcttgttcctaagagaggccaatgtgatgctcaccctgtctcatgtaagctacctgtttcaagttgaactaaactaaaattaatttcagccaaatgtgataaaattctacggagtatgcaccatgaaggagcccatcatgattgtcatggagttttgcgacgggaaatccctggaggacgctctactctccaaggaagaaaaagtgtcagctgaggacaagattctctaccttttccacgccgcctgcggtattgattatttgcacggaaagcaggttattcacagggatattgcggcgagaaattgtttgttgaattccaaaaagatcgtgagtttgtttttcaaaaatttctgaatctatgtgaatgaaaaaataaatttcagctgaaaatctccgactttggattgtcggtcaaaggagttgctataaaggagcgaaagggaggatgtctgccggtcaagtacatggctccggagacattgaagaaggggttgtacagtactgcctctgatatttataggtgagcctacgagcatacatagacattggtagtggcgtcagcggtggcctagaaaccttatccgcgtctgaaggttaatcaacctcacacaagtctctatgatttccagctacggcgctctaatgtacgaagtctacacggacggaaagacgccattcgaaacgtgcgggctacgtggaaatgagctccgaaaagcgatcatcgggaagagaatcagcttggccgttgaggtagagctaccagtgttcattgccaacattttcgagcaaagca