Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53G2.6   

sjj_F53G2.6 RNAi JA:F53G2.6
Simmer:F53G2.6
PCR_productsjj_F53G2.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53G2.6 Source_evidenceePCR749WS150 Sequence/Annotation Release
Overlaps_Gene F53G2.6 Source_evidenceePCR749WS150 Sequence/Annotation Release
Chunk_score Abs_score686
Max_abs_score686F53G2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII24679212469431
Overlaps_transcriptF53G2.6 Source_evidenceePCR749WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53G2.61511ctcagattttctggaatttccctttaaaaaaaaacatacggcagtaggttctgaaccactgcagacatcacaaaaagcgccgattccgactcttcccacgaggcgttgggcttatgacagcactcgataagcttctgatgcatcatttgaatacatttatccgagttcacaatgaatacaacatcacgtagagcttcgacggctttcaggcggaattctccaaattctgaagtttcatcgagtagatcatcgacgtcatcggcgtcaagtttacagtgttcgtagaggcattgaatgaatttctcagcgtacggacggaagcggccaatatattgatcatcgtcatatttgaagagctcttcggtgatacggtaccacacattgaatgacatctcgatgagctgcagcaagaaaattgcgatttttagcttgaaaatgaaattttatctgaaaatccgtgccaaaatcggattccccgctgttttattagtctaatcctaaattttcagctcaaaattcgaaaatcgcgtaaaatctggtgttttgggggtactgaagatggtgtttgcgtacttttggcgctaccgtaccccaggaaatttcaaaacaaagctagaaagttctagttttcgcggttcagactgaaattttatggggaaatcgaatttgagatgaaaattcaaaaattttaagcattttgttggatttctcgaatttttgccaattttcgatgtctcgtaataattttggccggtttttaatataaaattcgaattccccgctgctttcttagactaatcctaaaatttcagctcaaaattcgaaaatcgcgtaaaatctggtgttttcgggtactgtagtcggtgtttgcgtactcatggagctaccgtaacctccgagacttcaaaattgagctagtgagctctagttttcggtgtctaggctgaaattttgtggggaatctgaaaataatcgaattttagtcaacttacagcccaatcatggtgcttagcgactaggagcagaagctcaaagcatgccaggctcccgattgccgccggatccggattcgcttcgttgacgatttgcacatagaaggattcgaccatctcaacaaatatacgagcaatattctgaaaaatcgataatttattgattttttctggggaaaaattgattttttatggatttttccgccgaaaatcgatttctcacatttcccgggccgaaatttatcgattttctcaatttttcagctcaaaatccaccaaatttctccatttttccgctacctgaagccgatcaaaatcctccacttgctgagctttctcaaaagccgaaaccagtgaaatgactccgcgatgcacaacttctgcgagttttctgtgcatttctaggtcttcaacacgataaagtgcctgtacaatgcaatttgtcgcagtttcatggagacatgacggaattatcgggtcgatcgaggcgatcacgtggaaaatcatggaaattagtgg