Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54A3_31.e   

sjj_F54A3_31.e RNAi JA:F54A3_31.e
Simmer:F54A3_31.e
PCR_productsjj_F54A3_31.e
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54A3.3 Source_evidenceePCR468WS150 Sequence/Annotation Release
Overlaps_Gene F54A3.3 (3)
Overlaps_transcriptF54A3.3 Source_evidenceePCR555WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54A3_31.e2668ttttgaactggaaaatgctcaattttcactcaaaacatcccaaaaaatacagttttcagcctaaaaagttcgaagaaactgaattttaggcttaaaaactgcgatttatagccaaaaaattgaggttttctccaattttttactcaaaacattccaaaaaatgcaattttcagcccgaaaagtccagattttcactcaaaattctgttttcaaatcgaaaaaatcgccaaatcagctcaaaaattcgaattttagagtcaaaatcttacgaaaaatcccattttcaagtcgaaaaagcccgaaaattcccgattttcccctcaaaaacctccaaaaatccattaatttttgtaattttccaggtcgaacgtaatctccaagactctcttcacgtcgtccgtaacattatgatcaatccaaagcttgtaccaggtggcggagctcttgaaatggctttgagccgtgaaattgaacaacaaggagccaaaatggacggagttaagaaatggccgtataaggcgattggattggctcttgaagtgattccacggacattaattcagaattgtggaggttctacaattcgaaaaatgaccgaattgcgtgcgattcacgctcaaaacgctgaaaattggacttttggagtcgacggaacctcgggagacttggtacggcgctttgttgccgaaaattccgtgaaattcgagaaaattggctcaaaaactgaaaaattccgtaaaaatccgggaaaattgacctaaaaattagcgaaattcatcgaaaatcgaatttttattgaaaaatttcaaattttcagcaaaaaatatcgaaaactataaattttccatttgaagaaaaaatcgatttttcactggaattcccataaaatttgaatttttcgatgaattttgcgattttcgagctcaaaatcgagttccccgcgaaatttcagtcggaaaatcgaaaactagaggtttctagctcaattttgaaatttccgggggtacggtagcgccaaaagtacgcaaacacagactacagtccccccaaaacactcgatttcacgcgattttcgaattttgagctgaaaatttaagattagactaagaaaatggcgctgaaaacgaattttataataaaaatgcacagaaattattcggagctctcaaaaaatgagcaaattttcagaaaaccttgaattttaacccgaaaatttgaaaattgcaattttctataagaaaaatctggaaatggctcaatatcacttttttacatcaaaaattttggaaaattctggttaaaactagccaaaatcgatttttatcaccaaaaagtctagaaaatcctgatttttatggaatttgtcgattttccatataaaattcgaattccctgcaaaattgcaggcagaaaatcgaaatctagaggtttctagctcaattttgaaatttcccgggttacggtagcgccaaaagtacgcaaacaccgactacagtacccccaaaacacccgattttacgcaattttcgaattttgagctgaaaattgagttttagactaagaaaatggcggggaattcgaatttgaacaaaaaaactccgggaaaaatctctgaaaagctcaaaatgcaccaaaaatgctcattttcttgcaggttgacatgaacaaactggaaatctgggacccactggccgtccgtattcaagttctcaaaacagccatcgaaacatcggtaaggacgacgaggaaaatcggatttttcgcgaaattttgacgaaaaaagcggaaaattcgcggcttttcgcccggaaaaatggatttttccgttaattttgccgaatttcagctgagaattacaaaaaattcgaatttttcactcaaaaaatcgataaaaatatggaaaactacggaaaatttgagttttcgccggaaaaaacggaaaatttggcggaaaaatccaattttttgtggaaaaaaagcgatatttgactcaaaaaatcgaaatttttccgaaaattttcaaagatttcgctttaaaaaatttaaatttagcggaaattttcaatttttgactcaaaaaattgaaattttgacgaaaaaagcggaaaattcgcggcttttcgcccggaaaaatggatttttccgttaattttgccgaattatacctgaaaattgcaaaattgacggaaaattttcaatttttcaatgaaaaaactgaaaattttgaattttttggtcaaaaaaatcgaaatttggctgaaatgttgaacttttggtgaaaaaatcggaaattttaataaaaattcgattttttcactcaaaaaattgataaaaaaactatggaaaactactgaaaatttgaatttttcacataaaaacccaaattttggcggaaatttcaaagatttcgtcttaaaaaattaaaatttagcggaaattttgaatttttgactcaaaaaaaatcgatttttccactaaaatctcccaatttttgcaggttatgcttctccgtatcgacgatattgtttcgggaacaaagaaggctgtcggaggcgaaaaacaggaaatgatgccacaataaatcccttttttcttcattttttcattattttttcccttttttgtgagaatttttggacttttttgagtgaaaatttgacgaaaatcg